RAP1B (NM_001010942) Human Untagged Clone

SKU SC301546

RAP1B (untagged)-Human RAP1B, member of RAS oncogene family (RAP1B), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: RAP1B
• Synonyms: K-REV; RAL1B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC301546 representing NM_001010942.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACTGTACAATTT; GTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTA; GATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGAACGGAGCAATTTACAGCAATGAGGGAT; TTATACATGAAAAATGGACAAGGATTTGCATTAGTTTATTCCATCACAGCACAGTCCACATTTAACGAT; TTACAAGACCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGT; AATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGG; AACAACTGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTA; GTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCATGTCAGCTGCTT; TAA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001010942
• Insert Size: 555 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001010942.2
• RefSeq Size: 2163 bp
• RefSeq ORF: 555 bp
• Locus ID: 5908
• UniProt ID: P61224
• Cytogenetics: 12q15
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Renal cell carcinoma
• MW: 20.8 kDa
• Summary: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]; Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).