CST9 (NM_001008693) Human Untagged Clone

SKU
SC301339
CST9 (untagged)-Human cystatin 9 (testatin) (CST9)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CST9
Synonyms CLM; CTES7A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301339 representing NM_001008693.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGAGTCCGCAGAGGAGGAAGGCTATGCCCTGGGCACTGTCACTGCTTCTCATGGGCTTCCAGCTC
CTGGTGACTTATGCCTGGTGTTCTGAAGAGGAAATGGGTGGTAATAATAAAATAGTCCAGGATCCTATG
TTCCTCGCCACAGTGGAGTTTGCCTTGAACACTTTCAACGTGCAGAGCAAGGAGGAGCATGCCTACAGG
CTGTTGCGCGTCCTGAGTTCATGGAGGGAGGATAGCATGGACAGAAAGTGGCGAGGTAAGATGGTGTTC
TCCATGAATCTGCAACTGCGCCAAACCGTATGTAGGAAATTTGAAGATGACATTGACAACTGCCCTTTT
CAAGAAAGCCTGGAGCTGAACAACGTAAGACAGGGCATCAGCTTTCCTCAGGTCCACAGCTGTGGATGC
TGCATGGGGTGTGGTGTGGGCACAGGAGCAGCTGACAAAGCCATTCCGAGGGACAAAGGGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001008693
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001008693.2
RefSeq Size 1689 bp
RefSeq ORF 480 bp
Locus ID 128822
UniProt ID Q5W186
Cytogenetics 20p11.21
Protein Families Transmembrane
MW 18.1 kDa
Summary The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted protein that may play a role in hematopoietic differentiation or inflammation. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:CST9 (NM_001008693) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220815 CST9 (Myc-DDK-tagged)-Human cystatin 9 (testatin) (CST9) 10 ug
$150.00
RC220815L3 Lenti ORF clone of Human cystatin 9 (testatin) (CST9), Myc-DDK-tagged 10 ug
$450.00
RC220815L4 Lenti ORF clone of Human cystatin 9 (testatin) (CST9), mGFP tagged 10 ug
$450.00
RG220815 CST9 (tGFP-tagged) - Human cystatin 9 (testatin) (CST9) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.