DUSP13 (NM_001007272) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DUSP13 |
Synonyms | BEDP; DUSP13A; DUSP13B; MDSP; SKRP4; TMDP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC301205 representing NM_001007272.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGAGACCTCTCTCCCAGAGCTGGGGGGAGAGGACAAAGCCACGCCTTGCCCCAGCATCCTGGAG CTGGAGGAGCTCCTGCGGGCAGGGAAGTCTTCTTGCAGCCGTGTGGACGAAGTTTGGCCCAACCTTTTC ATAGGAGATGCGATGGACTCACTGCAGAAGCAGGACCTCCGGAGGCCCAAGATCCATGGGGCAGTCCAG GCATCTCCCTACCAGCCGCCCACATTGGCTTCGCTGCAGCGCTTGCTGTGGGTCCGTCAGGCTGCCACA CTGAACCATATCGATGAGGTCTGGCCCAGCCTCTTCCTGGGAGATGCGTACGCAGCCCGGGACAAGAGC AAGCTGATCCAGCTGGGAATCACCCACGTTGTGAATGCCGCTGCAGGCAAGTTCCAGGTGGACACAGGT GCCAAATTCTACCGTGGAATGTCCCTGGAGTACTATGGCATCGAGGCGGACGACAACCCCTTCTTCGAC CTCAGTGTCTACTTTCTGCCTGTTGCTCGATACATCCGAGCTGCCCTCAGTGTTCCCCAAGGCCGCGTG CTGGTACACTGTGCCATGGGGGTAAGCCGCTCTGCCACACTTGTCCTGGCCTTCCTCATGATCTGTGAG AACATGACGCTGGTAGAGGCCATCCAGACGGTGCAGGCCCACCGCAATATCTGCCCTAACTCAGGCTTC CTCCGGCAGCTCCAGGTTCTGGACAACCGACTGGGGCGGGAGACGGGGCGGTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007272 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001007272.1 |
RefSeq Size | 1063 bp |
RefSeq ORF | 747 bp |
Locus ID | 51207 |
UniProt ID | Q6B8I1 |
Cytogenetics | 10q22.2 |
Protein Families | Druggable Genome, Phosphatase |
MW | 27.5 kDa |
Summary | Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In mouse, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks several internal exons, compared to variant 1. The encoded protein, isoform 2 (also called TMDP-L2) has an alternate C-terminus, compared to isoform 1. Efforts to detect expression of isoform 2 were unsuccessful. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC218322 | DUSP13 (Myc-DDK-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 2 | 10 ug |
$300.00
|
|
RC218322L3 | Lenti ORF clone of Human dual specificity phosphatase 13 (DUSP13), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC218322L4 | Lenti ORF clone of Human dual specificity phosphatase 13 (DUSP13), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG218322 | DUSP13 (tGFP-tagged) - Human dual specificity phosphatase 13 (DUSP13), transcript variant 2 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.