SIAH Interacting Protein (CACYBP) (NM_001007214) Human Untagged Clone

SKU SC301165

CACYBP (untagged)-Human calcyclin binding protein (CACYBP), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: SIAH Interacting Protein
• Synonyms: GIG5; PNAS-107; S100A6BP; SIP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC301165 representing NM_001007214.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGCAACAGAAATCACAGAAGAAAGCAGAACTTCTTGATAATGAAAAACCAGCTGCTGTGGTTGCTCCC; ATTACAACGGGCTATACGGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATC; TACATTACCTTAACTGGAGTTCATCAAGTTCCCACTGAGAATGTGCAGGTGCATTTCACAGAGAGGTCA; TTTGATCTTTTGGTAAAGAATCTAAATGGGAAGAGTTACTCCATGATTGTGAACAATCTCTTGAAACCC; ATCTCTGTGGAAGGCAGTTCAAAAAAAGTCAAGACTGATACAGTTCTTATATTGTGTAGAAAGAAAGTG; GAAAACACAAGGTGGGATTACCTGACCCAGGTTGAAAAGGAGTGCAAAGAAAAAGAGAAGCCCTCCTAT; GACACTGAAACAGATCCTAGTGAGGGATTGATGAATGTTCTAAAGAAAATTTATGAAGATGGAGACGAT; GATATGAAGCGAACCATTAATAAAGCCTGGGTGGAATCAAGAGAGAAGCAAGCCAAAGGAGACACGGAA; TTTTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007214
• Insert Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001007214.1
• RefSeq Size: 2875 bp
• RefSeq ORF: 558 bp
• Locus ID: 27101
• UniProt ID: Q9HB71
• Cytogenetics: 1q25.1
• Protein Pathways: Wnt signaling pathway
• MW: 21.2 kDa
• Summary: The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]; Transcript Variant: This variant (2) has an alternate 5' exon, and uses a downstream AUG start codon, as compared to variant 1. The encoded isoform 2 has a shorter N-terminus, as compared to isoform 1.