ZSCAN2 (NM_001007072) Human Untagged Clone

SKU
SC301144
ZSCAN2 (untagged)-Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ZSCAN2
Synonyms ZFP29; ZNF854
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301144 representing NM_001007072.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGCTGCAGACATCCCGAGAGTGACCACTCCGCTGAGCTCCTTGGTCCAGGTGCCTCAAGAGGAA
GATAGACAGGAGGAGGAGGTCACCACCATGATCCTGGAGGATGACTCCTGGGTGCAAGAAGCTGTGCTG
CAGGAGGATGGCCCTGAGTCTGAGCCCTTTCCCCAGAGTGCTGGCAAGGGCGGCCCCCAGGAGGAGGTG
ACCAGGGGACCACAGGGTGCACTCGGCCGCCTCCGAGAGCTCTGCCGGCGCTGGCTGAGACCAGAGGTA
CACACCAAGGAGCAGATGTTAACCATGCTGCCAAAGGAAATTCAGGCTTGGCTGCAAGAGCATCGGCCT
GAAAGCAGTGAGGAGGCAGCGGCCCTGGTGGAAGACTTGACCCAGACCCTTCAGGACAGTGAAACAGCT
TCCTGCGTACATGGCTGCCCTGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001007072
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007072.1
RefSeq Size 951 bp
RefSeq ORF 441 bp
Locus ID 54993
UniProt ID Q7Z7L9
Cytogenetics 15q25.2
Protein Families Transcription Factors
MW 16.3 kDa
Summary The protein encoded by this gene contains several copies of zinc finger motif, which is commonly found in transcriptional regulatory proteins. Studies in mice show that this gene is expressed during embryonic development, and specifically in the testis in adult mice, suggesting that it may play a role in regulating genes in germ cells. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) has a different 3' terminal exon compared to transcript variants 1 and 2, resulting in the shortest isoform (3) with a distinct C-terminus.
Write Your Own Review
You're reviewing:ZSCAN2 (NM_001007072) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211929 ZSCAN2 (Myc-DDK-tagged)-Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3 10 ug
$150.00
RC211929L3 Lenti ORF clone of Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC211929L4 Lenti ORF clone of Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3, mGFP tagged 10 ug
$450.00
RG211929 ZSCAN2 (tGFP-tagged) - Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.