ATP8B2 (NM_001005855) Human Untagged Clone

SKU
SC301043
ATP8B2 (untagged)-Human ATPase, class I, type 8B, member 2 (ATP8B2), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ATP8B2
Synonyms ATPID
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301043 representing NM_001005855.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGTGTGTGCAAAAAAGCGCCCCCCAGAAGAAGAAAGGAGGGCGCGGGCTAATGACCGAGAATAC
AATGAGAAATTCCAGTATGCGAGTAACTGCATCAAGACCTCCAAGTACAATATTCTCACCTTCCTGCCT
GTCAACCTCTTTGAGCAGTTCCAGGAAGTTGCCAACACTTACTTCCTGTTCCTCCTCATTCTGCAGTTG
ATCCCCCAGATCTCTTCCCTGTCCTGGTTCACCACCATTGTGCCTTTGGTTCTTGTCCTCACCATCACA
GCTGTTAAAGATGCCACTGATGACTATTTCCGCCACAAGAGCGATAACCAGGTGAATAACCGCCAGTCT
CAGGTGCTGATCAATGGAATCCTCCAGCAGGAGCAGTGGATGAATGTCTGTGTTGGTGATATTATCAAG
CTAGAAAATAACCAGTTTGTGGCGGCGGATCTCCTCCTCCTTTCCAGCAGTGAGCCCCATGGGCTGTGT
TACATAGAGACAGCAGAACTTGATGGCGAGACCAACATGAAAGTACGTCAGGCGATTCCAGTCACCTCA
GAATTGGGAGACATCAGTAAGCTTGCCAAGTTTGACGGTGAAGTGATCTGTGAACCTCCCAACAACAAA
CTGGACAAATTCAGCGGAACCCTCTACTGGAAGGAAAATAAGTTCCCTCTGAGCAACCAGAACATGCTG
CTGCGGGGCTGTGTGCTGCGAAACACCGAGTGGTGCTTCGGGCTGGTCATCTTTGCAGGTCCCGACACT
AAGCTGATGCAAAACAGCGGCAGAACAAAGTTCAAAAGAACGAGTATCGATCGCCTAATGAATACCCTG
GTGCTCTGGATTTTTGGATTCCTGGTTTGCATGGGGGTGATCCTGGCCATTGGCAATGCCATCTGGGAG
CACGAGGTGGGGATGCGTTTCCAGGTCTACCTGCCGTGGGATGAGGCAGTGGACAGTGCCTTCTTCTCT
GGCTTCCTCTCCTTCTGGTCCTACATCATCATCCTCAACACCGTTGTGCCCATTTCACTCTATGTCAGG
TATGTGCCTTCTCTGACCTGGGGTCTCTCCAGGGAGTCAGGCGGTCCCATAGAACTTTTCTTTTCTATG
AAGATGAAGTCCTTGAGAAGTAACGAGAAGTCCTCTTCTTCCTGTACTGTAAACATTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001005855
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001005855.1
RefSeq Size 1560 bp
RefSeq ORF 1164 bp
Locus ID 57198
UniProt ID P98198
Cytogenetics 1q21.3
Protein Families Transmembrane
MW 44.2 kDa
Summary The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, in the 3' UTR and has multiple coding region differences, compared to variant 1. The resulting isoform (b) has a shorter N-terminus and contains a distinct C-terminus, compared to isoform a.
Write Your Own Review
You're reviewing:ATP8B2 (NM_001005855) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215926 ATP8B2 (Myc-DDK-tagged)-Human ATPase, class I, type 8B, member 2 (ATP8B2), transcript variant 2 10 ug
$457.00
RC215926L3 Lenti ORF clone of Human ATPase, class I, type 8B, member 2 (ATP8B2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC215926L4 Lenti ORF clone of Human ATPase, class I, type 8B, member 2 (ATP8B2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG215926 ATP8B2 (tGFP-tagged) - Human ATPase, class I, type 8B, member 2 (ATP8B2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.