DAZ2 (NM_001005786) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DAZ2 |
Synonyms | pDP1678 |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001005786, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCTGCAAATCCTGAGACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAG TCTTCATCAGCTGCAGCTAGCCAAGGCTGGGTGTTACCAGAAGGCAAAATCGTGCCAAAC ACTGTTTTTGTTGGTGGAATTGATGCTAGGATGGATGAAACTGAGATTGGAAGCTGCTTT GGTAGATACGGTTCAGTGAAAGAAGTGAAGATAATCACGAATCGAACTGGTGTGTCCAAA GGCTATGGATTTGTTTCGTTTGTTAATGACGTGGATGTCCAGAAGATAGTAGGATCACAG ATACATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGGAAACAAAAGTTATGT GCTCGTCATGTGCAGCCACGTCCTTTGGTAGTTAATCCTCCTCCTCCACCACAGTTTCAG AACGTCTGGCGGAATCCAAACACTGAAACCTACCTGCAGCCCCAAATCACGCCGAATCCT GTAACTCAGCACGTTCAGGCTTATTCTGCTTATCCACATTCACCAGGTCAGGTCATCACT GGATGTCAGTTGCTTGTATATAATTATCAGGAATATCCTACTTATCCCGATTCACCATTT CAGGTCACCACTGGATATCAGTTGCCTGTATATAATTATCAGCCATTTCCTGCTTATCCA AGTTCACCATTTCAGGTCACTGCTGGATATCAGTTGCCTGTATATAATTATCAGGCATTT CCTGCTTATCCAAGTTCACCATTTCAGGTCACCACTGGATATCAGTTGCCTGTATATAAT TATCAGGCATTTCCTGCTTATCCAAGTTCACCATTTCAGGTCACCACTGGATATCAGTTG CCTGTATATAATTATCAGGCATTTCCTGCTTATCCAAGTTCACCATTTCAGGTCACCACT GGATATCAGTTGCCTGTATATAATTATCAGGCATTTCCTGCTTATCCAAATTCAGCAGTT CAGGTCACCACTGGATATCAGTTCCATGTATACAATTACCAGATGCCACCGCAGTGCCCT GTTGGGGAGCAAAGGAGAAATCTGTGGACCGAAGCATACAAATGGTGGTATCTTGTCTGT TTAATCCAGAGAAGAGACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001005786 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001005786.1, NP_001005786.1 |
RefSeq Size | 3198 bp |
RefSeq ORF | 1101 bp |
Locus ID | 57055 |
UniProt ID | Q13117 |
Cytogenetics | Yq11.223 |
Summary | This gene is a member of the DAZ gene family and is a candidate for the human Y-chromosomal azoospermia factor (AZF). Its expression is restricted to premeiotic germ cells, particularly in spermatogonia. It encodes an RNA-binding protein that is important for spermatogenesis. Four copies of this gene are found on chromosome Y within palindromic duplications; one pair of genes is part of the P2 palindrome and the second pair is part of the P1 palindrome. Each gene contains a 2.4 kb repeat including a 72-bp exon, called the DAZ repeat; the number of DAZ repeats is variable and there are several variations in the sequence of the DAZ repeat. Each copy of the gene also contains a 10.8 kb region that may be amplified; this region includes five exons that encode an RNA recognition motif (RRM) domain. This gene contains one copy of the 10.8 kb repeat. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks several in-frame exons in the coding region, compared to variant 1. Variant 3 encodes isoform 3 which lacks eight DAZ repeats, compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.