HAO2 (NM_001005783) Human Untagged Clone

SKU
SC301035
HAO2 (untagged)-Human hydroxyacid oxidase 2 (long chain) (HAO2), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HAO2
Synonyms GIG16; HAOX2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301035 representing NM_001005783.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGACAAGATGTGGAGTGAATGTGAAGGTCCAGAAATGTCCTTGGTGTGTTTGACAGACTTTCAG
GCCCATGCGCGAGAGCAGCTGTCTAAGTCAACTCGGGATTTTATTGAAGGTGGAGCAGATGACAGCATC
ACGCGGGATGACAACATTGCAGCATTTAAAAGAATTCGCCTCCGTCCGCGGTACCTGAGAGATGTGTCT
GAGGTGGACACCAGAACCACAATCCAAGGGGAGGAGATCAGTGCCCCTATTTGTATCGCACCCACAGGG
TTCCACTGCCTTGTCTGGCCTGATGGGGAAATGAGCACAGCAAGAGCTGCCCAAGCGGCTGGTATCTGC
TACATCACCAGCACATTTGCCAGCTGTAGCCTTGAAGACATTGTCATTGCAGCTCCCGAAGGCCTCCGA
TGGTTCCAACTCTATGTGCATCCAGACCTGCAGCTGAACAAACAGTTGATCCAGAGGGTAGAATCCCTA
GGTTTCAAAGCTTTGGTAATAACTTTGGATACACCTGTATGTGGCAACAGGCGACATGACATTCGAAAC
CAGTTGAGGAGGAACTTAACACTAACAGATCTTCAATCACCTAAAAAGGGAAATGCAATACCTTATTTC
CAGATGACTCCTATCAGCACTTCTCTCTGCTGGAATGATCTCTCCTGGTTTCAGAGCATAACTCGATTG
CCCATCATCCTGAAAGGGATTTTGACAAAAGAGGATGCAGAGTTAGCTGTGAAGCACAATGTCCAGGGT
ATCATTGTTTCCAACCATGGTGGGAGGCAGCTTGATGAGGTTCTTGCTTCAATTGATGCTTTGACAGAA
GTGGTGGCTGCTGTAAAGGGGAAAATTGAAGTCTACCTGGATGGCGGGGTCCGAACTGGCAATGATGTG
CTGAAGGCTCTGGCCCTTGGAGCTAAGTGCATTTTTCTTGGGAGACCAATCCTATGGGGCCTTGCCTGC
AAGGGTGAACATGGTGTTAAGGAAGTTTTGAACATTTTAACAAATGAGTTCCACACTTCCATGGCCCTT
ACAGGCTGCCGGTCGGTCGCTGAGATCAATCGAAACTTGGTCCAGTTTTCCAGGCTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001005783
Insert Size 1095 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001005783.2
RefSeq Size 1708 bp
RefSeq ORF 1095 bp
Locus ID 51179
UniProt ID Q9NYQ3
Cytogenetics 1p12
Protein Pathways Glyoxylate and dicarboxylate metabolism, Metabolic pathways
MW 40.4 kDa
Summary This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) contains an alternate exon in the 5' region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a longer N-terminus than isoform 1.
Write Your Own Review
You're reviewing:HAO2 (NM_001005783) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218416 HAO2 (Myc-DDK-tagged)-Human hydroxyacid oxidase 2 (long chain) (HAO2), transcript variant 2 10 ug
$457.00
RC218416L3 Lenti ORF clone of Human hydroxyacid oxidase 2 (long chain) (HAO2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC218416L4 Lenti ORF clone of Human hydroxyacid oxidase 2 (long chain) (HAO2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG218416 HAO2 (tGFP-tagged) - Human hydroxyacid oxidase 2 (long chain) (HAO2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.