MARCHF2 (NM_001005415) Human Untagged Clone

SKU
SC300949
41335 (untagged)-Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MARCHF2
Synonyms HSPC240; MARCH-II; MARCH2; RNF172
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300949 representing NM_001005415.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGACGGGTGACTGCTGCCACCTCCCCGGCTCCCTGTGTGACTGCTCCGGCAGCCCTGCCTTCTCC
AAGGTCGTGGAGGCTACGGGCCTCGGACCGCCCCAGTATGTGGCACAGGTGACTTCAAGGGATGGCCGG
CTCCTCTCCACCGTCATCCGTGCCTTGGACACACCGAGTGATGGTCCTTTCTGCCGGATCTGCCATGAG
GGAGCGAACGGGGAGTGCTTGCTGTCCCCGTGTGGCTGCACCGGCACGCTGGGTGCCGTGCATAAGAGC
TGTCTGGAGAAGTGGCTTTCCTCATCTAACACCAGCTACTGCGAGCTGTGCCACACGGAGTTTGCAGTG
GAGAAACGGCCTCGACCCCTCACAGAGTGGCTGAAGGACCCGGGGCCGCGGACGGAGAAGCGGACACTG
TGCTGCGACATGGTGTGTTTCCTGTTCATCACACCGCTGGCCGCCATCTCAGGCTGGTTGTGCCTGCGC
GGGGCCCAGGACCACCTCCGGCTCCACAGCCAGCTGGAGGCCGTGGGTCTCATTGCCCTCACCATCGCC
CTCTTCACCATCTATGTCCTCTGGACGCTGGTCTCCTTCCGCTACCACTGCCAGCTGTACTCCGAGTGG
AGAAAGACCAACCAGAAAGTTCGCCTGAAGATCCGGGAGGCGGACAGCCCCGAGGGCCCCCAGCATTCT
CCACTGGCAGCTGGACTCCTGAAGAAGGTGGCAGAGGAGACACCAGTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001005415
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001005415.1
RefSeq Size 1434 bp
RefSeq ORF 741 bp
Locus ID 51257
UniProt ID Q9P0N8
Cytogenetics 19p13.2
Protein Families Druggable Genome, Transmembrane
MW 27 kDa
Summary MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]; Nakamura et al., 2005 [PubMed 15689499]).[supplied by OMIM, Mar 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 4. Variants 1, 2, and 4-7 all encode the longer isoform (1).
Write Your Own Review
You're reviewing:MARCHF2 (NM_001005415) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218593 MARCH2 (Myc-DDK-tagged)-Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2 10 ug
$300.00
RC218593L1 Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC218593L2 Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2, mGFP tagged 10 ug
$600.00
RC218593L3 Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC218593L4 Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2, mGFP tagged 10 ug
$600.00
RG218593 41335 (tGFP-tagged) - Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.