PLAUR (NM_001005376) Human Untagged Clone

SKU
SC300933
PLAUR (untagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PLAUR
Synonyms CD87; U-PAR; UPAR; URKR
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001005376 edited
CCTTCCTGAGGCCAGAAGGAGAGAAGACGTGCAGGGACCCCGCGCACAGGAGCTGCCCTC
GCGACATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAG
CCTCTTGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGT
GCGCCCTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAG
AGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCT
ATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCA
ACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTT
CCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCA
GCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGC
GTCCAAAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCA
ATGGTTTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCA
ACGAGGGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCT
GCAAGGGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAG
GCCCCATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACGCTCACTCTGGGGAAGCT
GGTTGCCATGTAAAAGTACTACTGCCCTGAGACCACCATGCTGTGAGGAAGCCCAAGCTA
CTCATGTATAAACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGA
CCTGGATGTCCAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCT
CACCATCACCCTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAAAC
CTGAAATCCCCCTCTCTGCCCTGGCTGGATCCGGGGGACCCCTTTGCCCTTCCCTCGGCT
CCCAGCCCTACAGACTTGCTGTGTGACCTCAGGCCAGTGTGCCGACCTCTCTGGGCCTCA
GTTTTCCCAGCTATGAAAACAGCTATCTCACAAAGTTGTGTGAAGCAGAAGAGAAAAGCT
GGAGGAAGGCCGTGGGCCAATGGGAGAGCTCTTGTTATTATTAATATTGTTGCCGCTGTT
GTGTTGTTGTTATTAATTAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_001005376
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001005376.1, NP_001005376.1
RefSeq Size 1437 bp
RefSeq ORF 846 bp
Locus ID 5329
UniProt ID Q03405
Cytogenetics 19q13.31
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Complement and coagulation cascades
Summary This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1. Variant 2 encodes the shortest isoform (2), also called suPLAUR, which is the soluble form of this protein. Isoform 2 lacks one of three LU (Ly-6 antigen/uPA receptor-like) domains, compared to isoform 1.
Write Your Own Review
You're reviewing:PLAUR (NM_001005376) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217929 PLAUR (Myc-DDK-tagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC217929L1 Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC217929L2 Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, mGFP tagged 10 ug
$600.00
RC217929L3 Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC217929L4 Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2, mGFP tagged 10 ug
$600.00
RG217929 PLAUR (tGFP-tagged) - Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.