OR8D4 (NM_001005197) Human Untagged Clone

SKU
SC300837
OR8D4 (untagged)-Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol OR8D4
Synonyms OR11-275
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300837 representing NM_001005197.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTA
CCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCC
ATGGGTGTAAAAAACCATTCCACAGTGACTGAGTTTCTTCTTTCAGGATTAACTGAACAAGCAGAGCTT
CAGCTGCCCCTCTTCTGCCTCTTCTTAGGAATTTACACAGTTACTGTGGTGGGAAACCTCAGCATGATC
TCAATTATTAGGCTGAATCGTCAACTTCATACCCCCATGTACTATTTCCTGAGTAGTTTGTCTTTTTTA
GATTTCTGCTATTCTTCTGTCATTACCCCTAAAATGCTATCAGGGTTTTTATGCAGAGATAGATCCATC
TCCTATTCTGGATGCATGATTCAGCTGTTTTTTTTCTGTGTTTGTGTTATTTCTGAATGCTACATGCTG
GCAGCCATGGCCTGCGATCGCTACGTGGCCATCTGCAGCCCACTGCTCTACAGGGTCATCATGTCCCCT
AGGGTCTGTTCTCTGCTGGTGGCTGCTGTCTTCTCAGTAGGTTTCACTGATGCTGTGATCCATGGAGGT
TGTATACTCAGGTTGTCTTTCTGTGGATCAAACATCATTAAACATTATTTCTGTGACATTGTCCCTCTT
ATTAAACTCTCCTGCTCCAGCACTTATATTGATGAGCTTTTGATTTTTGTCATTGGTGGATTTAACATG
GTGGCCACAAGCCTAACAATCATTATTTCATATGCTTTTATCCTCACCAGCATCCTGCGCATCCACTCT
AAAAAGGGCAGGTGCAAAGCGTTTAGCACCTGTAGCTCCCACCTGACAGCTGTTCTTATGTTTTATGGG
TCTCTGATGTCCATGTATCTCAAACCTGCTTCTAGCAGTTCACTCACCCAGGAGAAAGTATCCTCAGTA
TTTTATACCACTGTGATTCTCATGTTGAATCCCTTGATATATAGTCTGAGGAACAATGAAGTAAGAAAT
GCTCTGATGAAACTTTTAAGAAGAAAAATATCTTTATCTCCAGGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites AscI-MluI
ACCN NM_001005197
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001005197.1
RefSeq Size 945 bp
RefSeq ORF 945 bp
Locus ID 338662
UniProt ID Q8NGM9
Cytogenetics 11q24.1
Protein Families Transmembrane
Protein Pathways Olfactory transduction
MW 35 kDa
Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:OR8D4 (NM_001005197) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217547 OR8D4 (Myc-DDK-tagged)-Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC217547L1 Lenti ORF clone of Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4), Myc-DDK-tagged 10 ug
$600.00
RC217547L2 Lenti ORF clone of Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4), mGFP tagged 10 ug
$600.00
RC217547L3 Lenti ORF clone of Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4), Myc-DDK-tagged 10 ug
$600.00
RC217547L4 Lenti ORF clone of Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4), mGFP tagged 10 ug
$600.00
RG217547 OR8D4 (tGFP-tagged) - Human olfactory receptor, family 8, subfamily D, member 4 (OR8D4) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.