BMF (NM_001003940) Human Untagged Clone

SKU
SC300580
BMF (untagged)-Human Bcl2 modifying factor (BMF), transcript variant 1
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BMF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300580 representing NM_001003940.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCATCTCAGTGTGTGGAGGAGCTGGAGGATGATGTGTTCCAACCAGAGGATGGGGAGCCGGTG
ACCCAACCCGGGAGCTTGCTCTCTGCTGACCTGTTTGCCCAGAGCCTACTGGACTGCCCCCTCAGCCGA
CTTCAGCTCTTCCCTCTCACCCACTGCTGTGGCCCTGGCCTTCGACCCACCAGCCAGGAAGACAAAGCT
ACCCAGACTCTCAGCCCAGCCTCCCCCAGCCAAGGTGTCATGCTGCCTTGTGGGGTGACTGAGGAACCC
CAGCGACTCTTTTATGGCAATGCTGGCTATCGGCTTCCTCTCCCTGCCAGTTTCCCAGCAGTCTTGCCC
ATTGGGGAGCAGCCCCCCGAAGGGCAGTGGCAACATCAAGCAGAGGTACAGATTGCCCGAAAGCTTCAG
TGCATTGCAGACCAGTTCCACCGGCTTCATGTGCAGCAACACCAGCAGAACCAAAATCGTGTGTGGTGG
CAGATCCTCCTCTTCCTGCACAACCTTGCTTTGAATGGAGAAGAGAACAGGAACGGGGCAGGCCCTAGG
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001003940
Insert Size 555 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. These result in the substitution of 1 aa.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001003940.1
RefSeq Size 4700 bp
RefSeq ORF 555 bp
Locus ID 90427
UniProt ID Q96LC9
Cytogenetics 15q15.1
Protein Families Druggable Genome
MW 20.5 kDa
Summary The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript. Transcript variants 1 and 2 encode the longest isoform (bmf-1).
Write Your Own Review
You're reviewing:BMF (NM_001003940) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209733 BMF (Myc-DDK-tagged)-Human Bcl2 modifying factor (BMF), transcript variant 1 10 ug
$300.00
RC209733L1 Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC209733L2 Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, mGFP tagged 10 ug
$600.00
RC209733L3 Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC209733L4 Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, mGFP tagged 10 ug
$600.00
RG209733 BMF (tGFP-tagged) - Human Bcl2 modifying factor (BMF), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.