MARCH8 (NM_001002265) Human Untagged Clone

SKU
SC300429
41341 (untagged)-Human membrane-associated ring finger (C3HC4) 8 (MARCH8), transcript variant 6
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MARCH8
Synonyms c-MIR; MARCH-VIII; MIR; RNF178
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300429 representing NM_001002265.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCATGCCACTGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGA
AGTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCA
AGCAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGC
ACTTCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCC
CTGATCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATC
AAGAGCTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCA
CTGAGAAAATGGGAGAAGTTGCAGATGACGTCCAGCGAGCGCAGGAAGATCATGTGCTCAGTGACATTC
CACGTCATTGCCATCACATGTGTGGTCTGGTCCTTGTATGTGCTCATTGACCGTACTGCTGAGGAGATC
AAGCAGGGGCAGGCAACAGGAATCCTAGAATGGCCCTTTTGGACTAAATTGGTGGTTGTGGCCATCGGC
TTCACCGGAGGACTTCTTTTTATGTATGTTCAGTGTAAAGTGTATGTGCAATTGTGGAAGAGACTCAAG
GCCTATAATAGAGTGATCTATGTTCAAAACTGTCCAGAAACAAGCAAAAAGAATATTTTTGAAAAATCT
CCACTAACAGAGCCCAACTTTGAAAATAAACATGGATATGGAATCTGTCATTCCGACACAAACTCTTCT
TGTTGCACAGAGCCTGAAGACACTGGAGCAGAAATCATTCACGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001002265
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001002265.1
RefSeq Size 2604 bp
RefSeq ORF 876 bp
Locus ID 220972
Cytogenetics 10q11.21-q11.22
Protein Families Druggable Genome, Transmembrane
MW 33 kDa
Summary MARCH8 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH8 induces the internalization of several membrane glycoproteins (Goto et al., 2003 [PubMed 12582153]; Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Apr 2010]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.
Write Your Own Review
You're reviewing:MARCH8 (NM_001002265) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211771 MARCH8 (Myc-DDK-tagged)-Human membrane-associated ring finger (C3HC4) 8 (MARCH8), transcript variant 6 10 ug
$300.00
RC211771L3 Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 8 (MARCH8), transcript variant 6, Myc-DDK-tagged 10 ug
$600.00
RC211771L4 Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 8 (MARCH8), transcript variant 6, mGFP tagged 10 ug
$600.00
RG211771 41341 (tGFP-tagged) - Human membrane-associated ring finger (C3HC4) 8 (MARCH8), transcript variant 6 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.