ARL6IP4 (NM_001002252) Human Untagged Clone

SKU
SC300418
ARL6IP4 (untagged)-Human ADP-ribosylation-like factor 6 interacting protein 4 (ARL6IP4), transcript variant 4
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ARL6IP4
Synonyms SFRS20; SR-25; SRp25; SRrp37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300418 representing NM_001002252.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAGGGCAGGACCAGCCGGGGAGGAGGGCGGCGCGCGCGAGGGTCGCCTTCTTCCCAGGGCACCG
GGGGCGTGGGTGCTGCGGGCGTGCGCCGAGAGGGCAGCCTTGGAAGTGGGCGCAGCTTCGGCAGACACA
GGCGTGAGGGGCTGCGGAGCTCGAGGGCCGGCGCCCCTGCTTGCCTCTGCGGGAGGTGGGCGCGCCCGG
GACGGAACCTGGGGCGTCAGAACGAAAGGCAGCGGCGCCGCGCTTCCCAGCCGGCCAGCCTCCCGCGCA
GCGCCCCGGCCGGAAGCCTCCTCGCCGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCG
CAGGGCGGTCGAGCCCGCGGCGCCATGGCTCACGTCGGCTCCCGCAAGCGCTCGAGGAGTCGCAGCCGG
TCCCGGGGACGGGGGTCGGAAAAGAGAAAGAAGAAGAGCAGGAAAGACACCTCGAGGAACTGCTCGGCC
TCCACATCCCAAGAGAGAAGCAAGCAGAAGGCCCGGAGGAGAACAAGATCCAGCTCCTCCTCCTCTTCT
TCCAGTTCTTCTAGCTCCTCTTCTTCCTCCTCGTCCTCCTCCTCTTCCTCCAGTGATGGCCGGAAGAAG
CGGGGGAAGTACAAGGACAAGAGGAGGAAGAAGAAGAAGAAGAGGAAGAAGCTGAAGAAGAAGGGCAAG
GAGAAGGCGGAAGCACAGCAGGTGGAGGCTCTGCCGGGCCCCTCGCTGGACCAGTGGCACCGATCAGCT
GGGGAGGAAGAGGATGGCCCAGTCCTGACGGATGAGCAGAAGTCCCGAATCCAGGCCATGAAGCCCATG
ACCAAGGAGGAGTGGGATGCCCGGCAGAGCATCATCCGCAAGGTGGTGGACCCTGAGACGGGGCGCACC
AGGCTTATTAAGGGAGATGGCGAGGTCCTAGAGGAAATCGTAACCAAAGAACGACACAGAGAGATCAAC
AAGGTGGGTGTGGCCCCTCTGCCTGCCATCCGCCCCCAGCTCTGTTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001002252
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001002252.1
RefSeq Size 1681 bp
RefSeq ORF 1017 bp
Locus ID 51329
UniProt ID Q66PJ3
Cytogenetics 12q24.31
MW 36.2 kDa
Summary Involved in modulating alternative pre-mRNA splicing with either 5' distal site activation or preferential use of 3' proximal site. In case of infection by Herpes simplex virus (HSVI), may act as a splicing inhibitor of HSVI pre-mRNA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) has an alternate splice junction in the central region and an additional segment in the 3' region, compared to variant 1. The resulting isoform (4) lacks an internal segment and has a shorter and distinct C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:ARL6IP4 (NM_001002252) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213941 ARL6IP4 (Myc-DDK-tagged)-Human ADP-ribosylation-like factor 6 interacting protein 4 (ARL6IP4), transcript variant 4 10 ug
$457.00
RC213941L3 Lenti ORF clone of Human ADP-ribosylation-like factor 6 interacting protein 4 (ARL6IP4), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC213941L4 Lenti ORF clone of Human ADP-ribosylation-like factor 6 interacting protein 4 (ARL6IP4), transcript variant 4, mGFP tagged 10 ug
$757.00
RG213941 ARL6IP4 (tGFP-tagged) - Human ADP-ribosylation-like factor 6 interacting protein 4 (ARL6IP4), transcript variant 4 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.