Macrophage Inflammatory Protein 1 beta (CCL4L2) (NM_001001435) Human Untagged Clone

SKU SC300190

CCL4L1 (untagged)-Human chemokine (C-C motif) ligand 4-like 1 (CCL4L1)

Product Data

• Type: Human Untagged Clone
• Target Symbol: Macrophage Inflammatory Protein 1 beta
• Synonyms: AT744.2; CCL4L; LAG-1; LAG1; SCYA4L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC300190 representing NM_001001435.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCGTGCTAGTAGCTGCCTTCTGCTCTCTAGCACTCTCA; GCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCGAGGAAGCTTCCTCGCAAC; TTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAGCCAGCTGTGGTATTCCAAACCAAAAGA; GGCAAGCAAGTCTGCGCTGACCCCAGTGAGTCCTGGGTCCAGGAGTACGTGTATGACCTGGAACTGAAC; TGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001001435
• Insert Size: 279 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001001435.2
• RefSeq Size: 674 bp
• RefSeq ORF: 279 bp
• Locus ID: 9560
• Cytogenetics: 17q12
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway
• MW: 10.2 kDa
• Summary: This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. This gene copy contains a non-consensus splice acceptor site at the 3' terminal exon found in other highly similar gene copies, and it thus uses other alternative splice sites for the 3' terminal exon, resulting in multiple transcript variants. [provided by RefSeq, Apr 2014]