NKIRAS2 (NM_001001349) Human Untagged Clone

SKU
SC300171
NKIRAS2 (untagged)-Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NKIRAS2
Synonyms kappaB-Ras2; KBRAS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300171 representing NM_001001349.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAAGAGCTGCAAGGTGGTCGTGTGTGGCCAGGCGTCTGTGGGCAAAACTTCAATCCTGGAGCAG
CTTCTGTATGGGAACCATGTAGTGGGTTCGGAGATGATCGAGACGCAGGAGGACATCTACGTGGGCTCC
ATTGAGACAGACCGGGGGGTGCGAGAGCAGGTGCGTTTCTATGACACCCGGGGGCTCCGAGATGGGGCC
GAACTGCCCCGACACTGCTTCTCTTGCACTGATGGCTACGTCCTGGTCTATAGCACAGATAGCAGAGAG
TCTTTTCAGCGTGTGGAGCTGCTCAAGAAGGAGATTGACAAATCCAAGGACAAGAAGGAGGTCACCATC
GTGGTCCTTGGCAACAAGTGTGACTTACAGGAGCAGCGGCGTGTAGACCCAGATGTGGCTCAGCACTGG
GCCAAGTCAGAGAAGGTGAAGCTGTGGGAGGTGTCAGTGGCGGACCGGCGCTCCCTCCTGGAGCCCTTT
GTCTACTTGGCCAGCAAGATGACGCAACCCCAGAGCAAGTCTGCCTTCCCCCTCAGCCGGAAGAACAAG
GGCAGCGGCTCCTTGGATGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001001349
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001001349.2
RefSeq Size 2389 bp
RefSeq ORF 576 bp
Locus ID 28511
UniProt ID Q9NYR9
Cytogenetics 17q21.2
MW 21.5 kDa
Summary Atypical Ras-like protein that acts as a potent regulator of NF-kappa-B activity by preventing the degradation of NF-kappa-B inhibitor beta (NFKBIB) by most signals, explaining why NFKBIB is more resistant to degradation. May act by blocking phosphorylation of NFKBIB and nuclear localization of p65/RELA NF-kappa-B subunit. It is unclear whether it acts as a GTPase. Both GTP- and GDP-bound forms block phosphorylation of NFKBIB (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a. Variants 1-3 encode the same protein (isoform a).
Write Your Own Review
You're reviewing:NKIRAS2 (NM_001001349) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223273 NKIRAS2 (Myc-DDK-tagged)-Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 1 10 ug
$300.00
RC223273L3 Lenti ORF clone of Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC223273L4 Lenti ORF clone of Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG223273 NKIRAS2 (tGFP-tagged) - Human NFKB inhibitor interacting Ras-like 2 (NKIRAS2), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.