IL9 (NM_000590) Human Untagged Clone

SKU
SC300105
IL9 (untagged)-Human interleukin 9 (IL9)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL9
Synonyms HP40; IL-9; P40
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000590 edited
CCGCTGTCAAGATGCTTCTGGCCATGGTCCTTACCTCTGCCCTGCTCCTGTGCTCCGTGG
CAGGCCAGGGGTGTCCAACCTTGGCGGGGATCCTGGACATCAACTTCCTCATCAACAAGA
TGCAGGAAGATCCAGCTTCCAAGTGCCACTGCAGTGCTAATGTGACCAGTTGTCTCTGTT
TGGGCATTCCCTCTGACAACTGCACCAGACCATGCTTCAGTGAGAGACTGTCTCAGATGA
CCAATACCACCATGCAAACAAGATACCCACTGATTTTCAGTCGGGTGAAAAAATCAGTTG
AAGTACTAAAGAACAACAAGTGTCCATATTTTTCCTGTGAACAGCCATGCAACCAAACCA
CGGCAGGCAACGCGCTGACATTTCTGAAGAGTCTTCTGGAAATTTTCCAGAAAGAAAAGA
TGAGAGGGATGAGAGGCAAGATATGAAGATGAAA
Restriction Sites Please inquire
ACCN NM_000590
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000590.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000590.1, NP_000581.1
RefSeq Size 591 bp
RefSeq ORF 435 bp
Locus ID 3578
UniProt ID P15248
Cytogenetics 5q31.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Asthma, Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Summary The protein encoded by this gene is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. The gene encoding this cytokine has been identified as a candidate gene for asthma. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:IL9 (NM_000590) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209682 IL9 (Myc-DDK-tagged)-Human interleukin 9 (IL9) 10 ug
$150.00
RC209682L3 Lenti ORF clone of Human interleukin 9 (IL9), Myc-DDK-tagged 10 ug
$450.00
RC209682L4 Lenti ORF clone of Human interleukin 9 (IL9), mGFP tagged 10 ug
$450.00
RG209682 IL9 (tGFP-tagged) - Human interleukin 9 (IL9) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.