CYP11B2 (NM_000498) Human Untagged Clone
SKU
SC300084
CYP11B2 (untagged)-Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CYP11B2 (CYP11B2) |
Synonyms | ALDOS; CPN2; CYP11B; CYP11BL; CYPXIB2; P-450C18; P450aldo; P450C18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_000498 edited
ATGGCACTCAGGGCAAAGGCAGAGGTGTGCGTGGCAGCGCCCTGGCTGTCCCTGCAAAGG GCACGGGCACTGGGCACTAGAGCCGCTCGGGCCCCTAGGACGGTGCTGCCGTTTGAAGCC ATGCCCCAGCATCCAGGCAACAGGTGGCTGAGGCTGCTGCAGATCTGGAGGGAGCAGGGT TATGAGCACCTGCACCTGGAGATGCACCAGACCTTCCAGGAGCTGGGGCCCATTTTCAGG TACAACTTGGGAGGACCACGCATGGTGTGTGTGATGCTGCCGGAGGATGTGGAGAAGCTG CAACAGGTGGACAGCCTGCATCCCTGCAGGATGATCCTGGAGCCCTGGGTGGCCTACAGA CAACATCGTGGGCACAAATGTGGCGTGTTCTTGTTGAATGGGCCTGAATGGCGCTTCAAC CGATTGCGGCTGAACCCAGATGTGCTGTCGCCCAAGGCCGTGCAGAGGTTCCTCCCGATG GTGGATGCAGTGGCCAGGGACTTCTCCCAGGCCCTGAAGAAGAAGGTGCTGCAGAACGCC CGGGGGAGCCTGACCCTGGACGTCCAGCCCAGCATCTTCCACTACACCATAGAAGCCAGC AACTTAGCTCTTTTTGGAGAGCGGCTGGGCCTGGTTGGCCACAGCCCCAGTTCTGCCAGC CTGAACTTCCTCCATGCCCTGGAGGTCATGTTCAAATCCACCGTCCAGCTCATGTTCATG CCCAGGAGCCTGTCTCGCTGGATCAGCCCCAAGGTGTGGAAGGAGCACTTTGAGGCCTGG GACTGCATCTTCCAGTACGGTGACAACTGTATCCAGAAAATCTACCAGGAACTGGCCTTC AACCGCCCTCAACACTACACAGGCATCGTGGCGGAGCTCCTGTTGAAGGCGGAACTGTCA CTAGAAGCCATCAAGGCCAACTCTATGGAACTCACTGCAGGGAGCGTGGACACGACAGCG TTTCCCTTGCTGATGACGCTCTTTGAGCTGGCTCGGAACCCCGACGTGCAGCAGATCCTG CGCCAGGAGAGCCTGGCCGCCGCAGCCAGCATCAGTGAACATCCCCAGAAGGCAACCACC GAGCTGCCCTTGCTGCGGGCGGCCCTCAAGGAGACCTTGCGGCTCTACCCTGTGGGTCTG TTTTTGGAGCGAGTGGTGAGCTCAGACTTGGTGCTTCAGAACTACCACATCCCAGCTGGG ACATTGGTACAGGTTTTCCTCTACTCGCTGGGTCGCAATGCCGCCTTGTTCCCGAGGCCT GAGCGGTATAATCCCCAGCGCTGGCTAGACATCAGGGGCTCCGGCAGGAACTTCCACCAC GTGCCCTTTGGCTTTGGCATGCGCCAGTGCCTCGGGCGGCGCCTGGCAGAGGCAGAGATG CTGCTGCTGCTGCACCACGTGCTGAAGCACTTCCTGGTGGAGACACTAACTCAAGAGGAC ATAAAGATGGTCTACAGCTTCATATTGAGGCCTGGCACGTCCCCCCTCCTCACTTTCAGA GCGATTAACTAG |
Restriction Sites | Please inquire |
ACCN | NM_000498 |
Insert Size | 1500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000498.2. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000498.2, NP_000489.2 |
RefSeq Size | 2936 bp |
RefSeq ORF | 1512 bp |
Locus ID | 1585 |
UniProt ID | P19099 |
Cytogenetics | 8q24.3 |
Protein Families | Druggable Genome |
Protein Pathways | C21-Steroid hormone metabolism, Metabolic pathways |
Summary | This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC215476 | CYP11B2 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein | 10 ug |
$702.00
|
|
RC215476L1 | Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged | 10 ug |
$1,002.00
|
|
RC215476L2 | Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, mGFP tagged | 10 ug |
$1,002.00
|
|
RC215476L3 | Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged | 10 ug |
$1,002.00
|
|
RC215476L4 | Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, mGFP tagged | 10 ug |
$1,002.00
|
|
RG215476 | CYP11B2 (tGFP-tagged) - Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein | 10 ug |
$902.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.