CYP11B2 (NM_000498) Human Untagged Clone

SKU
SC300084
CYP11B2 (untagged)-Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein
$704.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CYP11B2 (CYP11B2)
Synonyms ALDOS; CPN2; CYP11B; CYP11BL; CYPXIB2; P-450C18; P450aldo; P450C18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000498 edited
ATGGCACTCAGGGCAAAGGCAGAGGTGTGCGTGGCAGCGCCCTGGCTGTCCCTGCAAAGG
GCACGGGCACTGGGCACTAGAGCCGCTCGGGCCCCTAGGACGGTGCTGCCGTTTGAAGCC
ATGCCCCAGCATCCAGGCAACAGGTGGCTGAGGCTGCTGCAGATCTGGAGGGAGCAGGGT
TATGAGCACCTGCACCTGGAGATGCACCAGACCTTCCAGGAGCTGGGGCCCATTTTCAGG
TACAACTTGGGAGGACCACGCATGGTGTGTGTGATGCTGCCGGAGGATGTGGAGAAGCTG
CAACAGGTGGACAGCCTGCATCCCTGCAGGATGATCCTGGAGCCCTGGGTGGCCTACAGA
CAACATCGTGGGCACAAATGTGGCGTGTTCTTGTTGAATGGGCCTGAATGGCGCTTCAAC
CGATTGCGGCTGAACCCAGATGTGCTGTCGCCCAAGGCCGTGCAGAGGTTCCTCCCGATG
GTGGATGCAGTGGCCAGGGACTTCTCCCAGGCCCTGAAGAAGAAGGTGCTGCAGAACGCC
CGGGGGAGCCTGACCCTGGACGTCCAGCCCAGCATCTTCCACTACACCATAGAAGCCAGC
AACTTAGCTCTTTTTGGAGAGCGGCTGGGCCTGGTTGGCCACAGCCCCAGTTCTGCCAGC
CTGAACTTCCTCCATGCCCTGGAGGTCATGTTCAAATCCACCGTCCAGCTCATGTTCATG
CCCAGGAGCCTGTCTCGCTGGATCAGCCCCAAGGTGTGGAAGGAGCACTTTGAGGCCTGG
GACTGCATCTTCCAGTACGGTGACAACTGTATCCAGAAAATCTACCAGGAACTGGCCTTC
AACCGCCCTCAACACTACACAGGCATCGTGGCGGAGCTCCTGTTGAAGGCGGAACTGTCA
CTAGAAGCCATCAAGGCCAACTCTATGGAACTCACTGCAGGGAGCGTGGACACGACAGCG
TTTCCCTTGCTGATGACGCTCTTTGAGCTGGCTCGGAACCCCGACGTGCAGCAGATCCTG
CGCCAGGAGAGCCTGGCCGCCGCAGCCAGCATCAGTGAACATCCCCAGAAGGCAACCACC
GAGCTGCCCTTGCTGCGGGCGGCCCTCAAGGAGACCTTGCGGCTCTACCCTGTGGGTCTG
TTTTTGGAGCGAGTGGTGAGCTCAGACTTGGTGCTTCAGAACTACCACATCCCAGCTGGG
ACATTGGTACAGGTTTTCCTCTACTCGCTGGGTCGCAATGCCGCCTTGTTCCCGAGGCCT
GAGCGGTATAATCCCCAGCGCTGGCTAGACATCAGGGGCTCCGGCAGGAACTTCCACCAC
GTGCCCTTTGGCTTTGGCATGCGCCAGTGCCTCGGGCGGCGCCTGGCAGAGGCAGAGATG
CTGCTGCTGCTGCACCACGTGCTGAAGCACTTCCTGGTGGAGACACTAACTCAAGAGGAC
ATAAAGATGGTCTACAGCTTCATATTGAGGCCTGGCACGTCCCCCCTCCTCACTTTCAGA
GCGATTAACTAG
Restriction Sites Please inquire
ACCN NM_000498
Insert Size 1500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000498.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000498.2, NP_000489.2
RefSeq Size 2936 bp
RefSeq ORF 1512 bp
Locus ID 1585
UniProt ID P19099
Cytogenetics 8q24.3
Protein Families Druggable Genome
Protein Pathways C21-Steroid hormone metabolism, Metabolic pathways
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:CYP11B2 (NM_000498) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215476 CYP11B2 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein 10 ug
$702.00
RC215476L1 Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$1,002.00
RC215476L2 Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$1,002.00
RC215476L3 Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$1,002.00
RC215476L4 Lenti ORF clone of Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$1,002.00
RG215476 CYP11B2 (tGFP-tagged) - Human cytochrome P450, family 11, subfamily B, polypeptide 2 (CYP11B2), nuclear gene encoding mitochondrial protein 10 ug
$902.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.