Wilms Tumor Protein (WT1) (NM_000378) Human Untagged Clone

SKU
SC300060
WT1 (untagged)-Human Wilms tumor 1 (WT1), transcript variant A
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Wilms Tumor Protein
Synonyms AWT1; GUD; NPHS4; WAGR; WIT-2; WT33
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000378 edited
CTGCAGGACCCGGCTTCCACGTGTGTCCCGGAGCCGGCGTCTCAGCACACGCTCCGCTCC
GGGCCTGGGTGCCTACAGCAGCCAGAGCAGCAGGGAGTCCGGGACCCGGGCGGCATCTGG
GCCAAGTTAGGCGCCGCCGAGGCCAGCGCTGAACGTCTCCAGGGCCGGAGGAGCCGCGGG
GCGTCCGGGTCTGAGCCGCAGCAAATGGGCTCCGACGTGCGGGACCTGAACGCGCTGCTG
CCCGCCGTCCCCTCCCTGGGTGGCGGCGGCGGCTGTGCCCTGCCTGTGAGCGGCGCGGCG
CAGTGGGCGCCGGTGCTGGACTTTGCGCCTCCGGGCGCTTCGGCTTACGGGTCGTTGGGC
GGCCCCGCGCCGCCACCGGCTCCGCCGCCACCCCCGCCGCCGCCGCCTCACTCCTTCATC
AAACAGGAGCCGAGCTGGGGCGGCGCGGAGCCGCACGAGGAGCAGTGCCTGAGCGCCTTC
ACTGTCCACTTTTCCGGCCAGTTCACTGGCACAGCCGGAGCCTGTCGCTACGGGCCCTTC
GGTCCTCCTCCGCCCAGCCAGGCGTCATCCGGCCAGGCCAGGATGTTTCCTAACGCGCCC
TACCTGCCCAGCTGCCTCGAGAGCCAGCCCGCTATTCGCAATCAGGGTTACAGCACGGTC
ACCTTCGACGGGACGCCCAGCTACGGTCACACGCCCTCGCACCATGCGGCGCAGTTCCCC
AACCACTCATTCAAGCATGAGGATCCCATGGGCCAGCAGGGCTCGCTGGGTGAGCAGCAG
TACTCGGTGCCGCCCCCGGTCTATGGCTGCCACACCCCCACCGACAGCTGCACCGGCAGC
CAGGCTTTGCTGCTGAGGACGCCCTACAGCAGTGACAATTTATACCAAATGACATCCCAG
CTTGAATGCATGACCTGGAATCAGATGAACTTAGGAGCCACCTTAAAGGGCCACAGCACA
GGGTACGAGAGCGATAACCACACAACGCCCATCCTCTGCGGAGCCCAATACAGAATACAC
ACGCACGGTGTCTTCAGAGGCATTCAGGATGTGCGGCGTGTGCCTGGAGTAGCCCCGACT
CTTGTACGGTCGGCATCTGAGACCAGTGAGAAACGCCCCTTCATGTGTGCTTACCCAGGC
TGCAATAAGAGATATTTTAAGCTGTCCCACTTACAGATGCACAGCAGGAAGCACACTGGT
GAGAAACCATACCAGTGTGACTTCAAGGACTGTGAACGAAGGTTTTCTCGTTCAGACCAG
CTCAAAAGACACCAAAGGAGACATACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAG
CGAAAGTTCTCCCGGTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTGAAAAG
CCCTTCAGCTGTCGGTGGCCAAGTTGTCAGAAAAAGTTTGCCCGGTCAGATGAATTAGTC
CGCCATCACAACATGCATCAGAGAAACATGACCAAACTCCAGCTGGCGCTTTGA
Restriction Sites Please inquire
ACCN NM_000378
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000378.3, NP_000369.3
RefSeq Size 2969 bp
RefSeq ORF 1494 bp
Locus ID 7490
UniProt ID P19544
Cytogenetics 11p13
Protein Families Druggable Genome, Transcription Factors
Summary This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Mar 2015]
Transcript Variant: This variant (A) lacks an alternate in-frame exon and uses an alternate, in-frame splice site in the 3' coding region, compared to variant D. This results in a shorter protein (isoform A), compared to isoform D. It initiates translation from a non-AUG (CUG) site, and also from a downstream, in-frame AUG. CCDS Note: The coding region has been updated to start at a non-AUG translation start codon that is supported by a publication and protein conservation.
Write Your Own Review
You're reviewing:Wilms Tumor Protein (WT1) (NM_000378) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220079 WT1 (Myc-DDK-tagged)-Human Wilms tumor 1 (WT1), transcript variant A 10 ug
$457.00
RC220079L1 Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant A, Myc-DDK-tagged 10 ug
$757.00
RC220079L2 Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant A, mGFP tagged 10 ug
$757.00
RC220079L3 Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant A, Myc-DDK-tagged 10 ug
$757.00
RC220079L4 Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant A, mGFP tagged 10 ug
$757.00
RG220079 WT1 (tGFP-tagged) - Human Wilms tumor 1 (WT1), transcript variant A 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.