TTPA (NM_000370) Human Untagged Clone

SKU
SC300058
TTPA (untagged)-Human tocopherol (alpha) transfer protein (TTPA)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TTPA
Synonyms alphaTTP; ATTP; AVED; TTP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300058 representing NM_000370.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGAGGCGCGATCCCAGCCCTCGGCGGGGCCGCAGCTCAACGCGCTACCGGACCACTCTCCGTTG
CTGCAGCCGGGCCTGGCGGCGCTGCGGCGCCGGGCCCGGGAAGCTGGCGTCCCGCTCGCGCCGCTGCCG
CTCACCGACTCCTTCCTGCTGCGGTTCCTGCGCGCCCGGGATTTCGATCTGGACCTGGCCTGGCGGTTA
CTAAAAAACTATTATAAGTGGAGAGCAGAATGTCCAGAAATAAGTGCAGATCTACACCCTAGAAGTATT
ATTGGCCTCCTAAAGGCTGGCTACCATGGAGTCCTGAGATCCAGGGATCCCACTGGCAGCAAAGTTCTT
ATTTACAGAATCGCACACTGGGACCCCAAAGTTTTTACAGCTTATGACGTATTTCGAGTAAGTCTAATC
ACATCCGAGCTTATTGTACAGGAGGTAGAAACTCAGCGGAATGGAATCAAGGCTATCTTTGATCTGGAA
GGTTGGCAGTTTTCTCATGCTTTTCAAATCACTCCATCCGTAGCCAAGAAGATTGCTGCTGTACTTACG
GATTCATTTCCATTGAAAGTTCGTGGCATCCATTTGATAAATGAACCAGTAATTTTCCATGCTGTCTTT
TCCATGATCAAACCATTCCTGACTGAAAAAATTAAGGAACGGATTCACATGCATGGGAACAACTACAAA
CAAAGCTTGCTTCAGCATTTCCCAGACATTCTTCCTCTGGAATATGGTGGTGAAGAATTCTCCATGGAG
GACATTTGTCAGGAATGGACAAATTTTATAATGAAGTCTGAAGATTATCTCAGCAGCATTTCTGAGAGC
ATTCAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_000370
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000370.3
RefSeq Size 2633 bp
RefSeq ORF 837 bp
Locus ID 7274
UniProt ID P49638
Cytogenetics 8q12.3
Protein Families Druggable Genome
MW 31.7 kDa
Summary This gene encodes a soluble protein that binds alpha-trocopherol, a form of vitamin E, with high selectivity and affinity. This protein plays an important role in regulating vitamin E levels in the body by transporting vitamin E between membrane vesicles and facilitating the secretion of vitamin E from hepatocytes to circulating lipoproteins. Mutations in this gene cause hereditary vitamin E deficiency (ataxia with vitamin E deficiency, AVED) and retinitis pigmentosa. [provided by RefSeq, Nov 2009]
Write Your Own Review
You're reviewing:TTPA (NM_000370) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208877 TTPA (Myc-DDK-tagged)-Human tocopherol (alpha) transfer protein (TTPA) 10 ug
$300.00
RC208877L3 Lenti ORF clone of Human tocopherol (alpha) transfer protein (TTPA), Myc-DDK-tagged 10 ug
$600.00
RC208877L4 Lenti ORF clone of Human tocopherol (alpha) transfer protein (TTPA), mGFP tagged 10 ug
$600.00
RG208877 TTPA (tGFP-tagged) - Human tocopherol (alpha) transfer protein (TTPA) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.