BCL3 (NM_005178) Human Untagged Clone

CAT#: SC128102

BCL3 (untagged)-Human B-cell CLL/lymphoma 3 (BCL3)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BCL3 (NM_005178) Human Untagged Clone
Symbol BCL3
Synonyms BCL4; D19S37
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005178 edited
ATGCCCCAATGCCCCGCGGGGGCCATGGACGAGGGGCCCGTGGACCTGCGCACCCGGCCC
AAGGCCGCCGGACTCCCGGGCGCCGCGCTGCCGCTCCGCAAGCGCCCGCTGCGCGCGCCC
TCCCCGGAGCCCGCCGCTCCCCGCGGCGCTGCGGGCCTTGTCGTCCCCCTGGACCCTCTG
CGCGGCGGCTGCGACCTGCCGGCGGTCCCCGGGCCCCCCCACGGCCTGGCCCGGCCGGAG
GCGCTTTACTACCCCGGAGCCTTACTGCCTTTGTACCCCACTCGGGCCATGGGCTCCCCG
TTTCCTCTGGTGAACCTGCCTACACCCCTATACCCCATGATGTGCCCCATGGAACACCCC
CTTTCTGCTGACATCGCCATGGCCACCCGTGCAGATGAGGACGGAGACACGCCTCTCCAT
ATTGCTGTGGTGCAGGGTAACCTGCCAGCTGTGCACCGGCTGGTCAACCTCTTCCAGCAG
GGGGGCCGGGAGCTCGACATCTACAACAACCTACGGCAGACACCGCTCCACCTGGCTGTG
ATCACCACATTACCGTCTGTGGTCCGGCTCCTGGTGACAGCTGGTGCCAGCCCCATGGCG
CTGGACCGCCATGGCCAGACGGCCGCTCACCTGGCGTGCGAGCACCGCAGCCCGACCTGC
CTGCGAGCCCTGCTGGACAGCGCAGCTCCGGGCACGTTGGACCTGGAGGCCCGCAATTAT
GACGGGCTCACCGCCCTGCACGTGGCAGTGAACACCGAGTGCCAAGAAACCGTGCAGCTC
TTGCTAGAGCGCGGTGCCGACATCGACGCAGTGGACATTAAGAGCGGCCGCTCCCCGCTC
ATCCACGCCGTGGAAAACAACAGCCTTAGCATGGTGCAGCTGCTGCTGCAGCACGGCGCC
AACGTGAACGCGCAAATGTACTCCGGCAGCTCCGCCCTGCACTCAGCGTCCGGCCGCGGG
CTCCTCCCGCTGGTGCGCACGCTGGTCCGCAGCGGCGCTGACAGCAGCCTCAAGAACTGC
CACAACGACACGCCGCTCATGGTGGCGCGCAGCCGCAGGGTCATCGACATCCTGAGGGGG
AAGGCCACCCGGCCTGCTTCCACCTCCCAGCCAGACCCCTCCCCTGACCGGAGCGCCAAC
ACCTCCCCCGAGAGCAGCAGCCGCCTCAGCTCCAATGGTCTTCTCTCCGCATCACCATCC
TCCTCACCCTCCCAGTCTCCCCCCAGGGACCCCCCTGGATTCCCCATGGCTCCTCCCAAT
TTCTTCCTTCCTTCCCCATCTCCACCCGCCTTCCTGCCCTTTGCTGGGGTCCTCCGAGGC
CCTGGCCGGCCGGTGCCCCCCTCCCCAGCTCCAGGAGGCAGCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005178 unedited
TTTGTAATACGACTCACTATAGGGCGGCACGCGAATTCGCACCAGGCCGGCACCGCCCCG
GCCGACAAAAGTCCCTTCATTTCATCCGGCTGCAGGGGAAGTCCCGGCGCCCGGCGAAAC
CACCCTCCCGTGCAGCCGAGCCCATCCGCTCTCCGGCCGCCGTCCCCGGCGGCCCCATGC
CCCAATGCCCCGCGGGGGCCATGGACGATGGGCCCGTGGACCTGCGCACCCGGCCCAAGG
CCGCCGGACTCCCGGGCGCCGCGCTGCCGCTCCGCAAGCGCCCGCTGCGCGCGCCCTCCC
CGGAGCCCGCCGCTCCCCGCGGCGCTGCGGGCCTTGTCGTCCCCCTGGACCCTCTGCGCG
GCGGCTGCGACCTGCCGGCGGTCCCCGGGCCCCCCCACGGCCTGGCCCGGCCGGAGGCGC
TTTACTACCCCGGAGCCTTACTGCCTTTGTACCCCACTCGGGCCATGGGCTCCCCGTTTC
CTCTGGTGAACCTGCCTACACCCCTATACCCCATGATGTGCCCCATGGAACACCCCCTTT
CTGCTGACATCGCCATGGCCACCCGTGCAGATGATGACGGAGACACGCCTCTCCATATTG
CTGTGGTGCATGGTAACCTGCCAGCTGTGCACCGGCTGGTCAACCTCCTTCAGCATGGAG
GGCCCGGGAGCTCGACATCTACAACAACCTACAGCAGACACCGCTNCACCTGGCTGTGAT
CACCACATTACCGTCTGTAGTCCAGCTCCTGGTGACAGCTGGTGCCAGCCCCATGGCGCT
AGACCGNCATGCCCAGATCGGCGCTCACCTGGCGTGCGATCACCGCATCCCGACCTGCCT
GCGAGCCCTGCTGGAAGCGCATCTCAGGCACGTTGGACCTGGAGCCNGCATTATGAGGNC
TCACGNCCTGCACGTGCATGACACCGATGCCATAATCGGCAGTCTGCTAATCCGTGCGAC
TCNACCATGGCATTAGACGGNCGTCCGTCATCAGCGGGAACACANCTANATGGGACTGTG
TGANAGGGCCACG
3' Read Nucleotide Sequence
>OriGene 3' genomic read for NM_005178 unedited
TTTTTTTTTTTTTTTATGGTACAAAATAGTTTATTACAAAANAAATCCAACCAAAATGCT
TAATAATTTACATCGTGATCCGTGCCCGTTACGGCCCACCTCTCCCCTCCTCAGTTATCT
GGTAGAGAGTGGAGGGGAGTGGCTGTTCCCTGGGTCCACCAGCTCTGGGAGGGGACATGG
AAATGGAAGATGTGGGTGGCATTCCGGACAGGGACTGGTGCCTGAGAATGCTGGGGTCAG
AGTCCTGGGAGGGAGCGAGATGGGGGAACATCTGTGCTCACAAGAGGGGGTGTATGGGTA
GGTGCATGTGCTTCTGTGCAAATCCTGGTCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005178
ORF Size 1341 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005178.2, NP_005169
RefSeq Size 1813
RefSeq ORF 1341
Locus ID 602
Cytogenetics 19q13.32
Domains ANK
Protein Families Transcription Factors, Druggable Genome
Gene Summary This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations