BCL3 (NM_005178) Human Untagged Clone

CAT#: SC128102

Reviews ()
Write a review

BCL3 (untagged)-Human B-cell CLL/lymphoma 3 (BCL3)



  "NM_005178" in other vectors (7)

Reconstitution Protocol

USD 477.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL3
Synonyms BCL4; D19S37
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005178 edited
ATGCCCCAATGCCCCGCGGGGGCCATGGACGAGGGGCCCGTGGACCTGCGCACCCGGCCC
AAGGCCGCCGGACTCCCGGGCGCCGCGCTGCCGCTCCGCAAGCGCCCGCTGCGCGCGCCC
TCCCCGGAGCCCGCCGCTCCCCGCGGCGCTGCGGGCCTTGTCGTCCCCCTGGACCCTCTG
CGCGGCGGCTGCGACCTGCCGGCGGTCCCCGGGCCCCCCCACGGCCTGGCCCGGCCGGAG
GCGCTTTACTACCCCGGAGCCTTACTGCCTTTGTACCCCACTCGGGCCATGGGCTCCCCG
TTTCCTCTGGTGAACCTGCCTACACCCCTATACCCCATGATGTGCCCCATGGAACACCCC
CTTTCTGCTGACATCGCCATGGCCACCCGTGCAGATGAGGACGGAGACACGCCTCTCCAT
ATTGCTGTGGTGCAGGGTAACCTGCCAGCTGTGCACCGGCTGGTCAACCTCTTCCAGCAG
GGGGGCCGGGAGCTCGACATCTACAACAACCTACGGCAGACACCGCTCCACCTGGCTGTG
ATCACCACATTACCGTCTGTGGTCCGGCTCCTGGTGACAGCTGGTGCCAGCCCCATGGCG
CTGGACCGCCATGGCCAGACGGCCGCTCACCTGGCGTGCGAGCACCGCAGCCCGACCTGC
CTGCGAGCCCTGCTGGACAGCGCAGCTCCGGGCACGTTGGACCTGGAGGCCCGCAATTAT
GACGGGCTCACCGCCCTGCACGTGGCAGTGAACACCGAGTGCCAAGAAACCGTGCAGCTC
TTGCTAGAGCGCGGTGCCGACATCGACGCAGTGGACATTAAGAGCGGCCGCTCCCCGCTC
ATCCACGCCGTGGAAAACAACAGCCTTAGCATGGTGCAGCTGCTGCTGCAGCACGGCGCC
AACGTGAACGCGCAAATGTACTCCGGCAGCTCCGCCCTGCACTCAGCGTCCGGCCGCGGG
CTCCTCCCGCTGGTGCGCACGCTGGTCCGCAGCGGCGCTGACAGCAGCCTCAAGAACTGC
CACAACGACACGCCGCTCATGGTGGCGCGCAGCCGCAGGGTCATCGACATCCTGAGGGGG
AAGGCCACCCGGCCTGCTTCCACCTCCCAGCCAGACCCCTCCCCTGACCGGAGCGCCAAC
ACCTCCCCCGAGAGCAGCAGCCGCCTCAGCTCCAATGGTCTTCTCTCCGCATCACCATCC
TCCTCACCCTCCCAGTCTCCCCCCAGGGACCCCCCTGGATTCCCCATGGCTCCTCCCAAT
TTCTTCCTTCCTTCCCCATCTCCACCCGCCTTCCTGCCCTTTGCTGGGGTCCTCCGAGGC
CCTGGCCGGCCGGTGCCCCCCTCCCCAGCTCCAGGAGGCAGCTGA
>OriGene 5' read for NM_005178 unedited
TTTGTAATACGACTCACTATAGGGCGGCACGCGAATTCGCACCAGGCCGGCACCGCCCCG
GCCGACAAAAGTCCCTTCATTTCATCCGGCTGCAGGGGAAGTCCCGGCGCCCGGCGAAAC
CACCCTCCCGTGCAGCCGAGCCCATCCGCTCTCCGGCCGCCGTCCCCGGCGGCCCCATGC
CCCAATGCCCCGCGGGGGCCATGGACGATGGGCCCGTGGACCTGCGCACCCGGCCCAAGG
CCGCCGGACTCCCGGGCGCCGCGCTGCCGCTCCGCAAGCGCCCGCTGCGCGCGCCCTCCC
CGGAGCCCGCCGCTCCCCGCGGCGCTGCGGGCCTTGTCGTCCCCCTGGACCCTCTGCGCG
GCGGCTGCGACCTGCCGGCGGTCCCCGGGCCCCCCCACGGCCTGGCCCGGCCGGAGGCGC
TTTACTACCCCGGAGCCTTACTGCCTTTGTACCCCACTCGGGCCATGGGCTCCCCGTTTC
CTCTGGTGAACCTGCCTACACCCCTATACCCCATGATGTGCCCCATGGAACACCCCCTTT
CTGCTGACATCGCCATGGCCACCCGTGCAGATGATGACGGAGACACGCCTCTCCATATTG
CTGTGGTGCATGGTAACCTGCCAGCTGTGCACCGGCTGGTCAACCTCCTTCAGCATGGAG
GGCCCGGGAGCTCGACATCTACAACAACCTACAGCAGACACCGCTNCACCTGGCTGTGAT
CACCACATTACCGTCTGTAGTCCAGCTCCTGGTGACAGCTGGTGCCAGCCCCATGGCGCT
AGACCGNCATGCCCAGATCGGCGCTCACCTGGCGTGCGATCACCGCATCCCGACCTGCCT
GCGAGCCCTGCTGGAAGCGCATCTCAGGCACGTTGGACCTGGAGCCNGCATTATGAGGNC
TCACGNCCTGCACGTGCATGACACCGATGCCATAATCGGCAGTCTGCTAATCCGTGCGAC
TCNACCATGGCATTAGACGGNCGTCCGTCATCAGCGGGAACACANCTANATGGGACTGTG
TGANAGGGCCACG
>OriGene 3' genomic read for NM_005178 unedited
TTTTTTTTTTTTTTTATGGTACAAAATAGTTTATTACAAAANAAATCCAACCAAAATGCT
TAATAATTTACATCGTGATCCGTGCCCGTTACGGCCCACCTCTCCCCTCCTCAGTTATCT
GGTAGAGAGTGGAGGGGAGTGGCTGTTCCCTGGGTCCACCAGCTCTGGGAGGGGACATGG
AAATGGAAGATGTGGGTGGCATTCCGGACAGGGACTGGTGCCTGAGAATGCTGGGGTCAG
AGTCCTGGGAGGGAGCGAGATGGGGGAACATCTGTGCTCACAAGAGGGGGTGTATGGGTA
GGTGCATGTGCTTCTGTGCAAATCCTGGTCC
Restriction Sites NotI-NotI     
ACCN NM_005178
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005178.2, NP_005169.1
RefSeq Size 1813 bp
RefSeq ORF 1341 bp
Locus ID 602
UniProt ID P20749
Cytogenetics 19q13.32
Domains ANK
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]

Other Versions

Other products for "BCL3"
Frequently bought together (4)
Rabbit Polyclonal Anti-BCL3 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.