Protein kinase Y linked (PRKY) (NM_002760) Human Untagged Clone

SKU
SC126856
PRKY (untagged)-Human protein kinase, Y-linked (PRKY)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Protein kinase Y linked
Synonyms OTTHUMP00000033227; protein kinase, Y-linked
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002760 edited
GGACCTGAGTGCCTCCCCATGGAGGCGCCCGGGCCGGCCCAGGCGGCCGCGGCGGAGAGC
AACTCCCGAGAGGTGACGGAGGATGCCGCCGACTGGGCGCCCGCGCTCTGCCCCAGCCCC
GAGGCGCGGTCGCCGGAGGCGCCTGCCTACCGCCTGCAGGACTGCGACGCGCTGGTCACC
ATGGGCACTGGGACGTTCGGGCGGGTGCACCTGGTGAAGGAGAAGACAGCCAAGCATTTC
TTCGCCCTCAAGGTGATGAGCATTCCCGACGTCATCCGCCGGAAGCAGGAGCAGCACGTG
CACAATGAGAAGTCTGTCCTGAAGGAAGTCAGCCACCCGTTCCTCATCAGGCTGTTCTGG
ACGTGGCATGAGGAGCGCTTCCTCTACATGCTCATGGAGTATGTGCCGGGTGGCGAGCTC
TTCAGCTACCTGCGCAACCGGGGGCACTTCTCCAGCACCACGGGGCTCTTCTACTCTGCG
GAGATCATCTGTGCCATTGAGTACCTGCACTCCAAGGAGATCGTCTACAGGGATTTGAAG
CCGGAGAACATCCTGCTGGATAGGGATGGTCACATCAAGCTCACGGACTTTGGGTTTGCC
AAGAAGCTGGTAGACAGGACTTGGACCCTCTGTGGAACACCCGAGTACCTAGCCCCCGAA
GTCATTCAGAGCAAGGGCCACGGAAGGGCCGTGGACTGGTGGGCCCTCGGCATCCTGATA
TTCGAGATGCTTTCGGGGTTTCCTCCATTTTTTGATGACAACCCGTTTGGCATTTATCAG
AAAATTCTTGCAGGCAAACTATATTTCCCCAGACATTTGGATTTCCATGTAAAAACGGGG
CGAATGATGTGAAACACCATCGGTGGTTCCGCTCCGTGGACTGGAAAGCTGTTCC
Restriction Sites Please inquire
ACCN NM_002760
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002760.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002760.2, NP_002751.1
RefSeq Size 7228 bp
RefSeq ORF 834 bp
Locus ID 5616
Cytogenetics Yp11.2
Domains pkinase, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase
Summary This gene is similar to the protein kinase, X-linked gene in the pseudoautosomal region of the X chromosome. The gene is classified as a transcribed pseudogene because it has lost a coding exon that results in all transcripts being candidates for nonsense-mediated decay (NMD) and unlikely to express a protein. Abnormal recombination between this gene and a related gene on chromosome X is a frequent cause of XX males and XY females. [provided by RefSeq, Jul 2010]
Write Your Own Review
You're reviewing:Protein kinase Y linked (PRKY) (NM_002760) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210438 PRKY (Myc-DDK-tagged)-Human protein kinase, Y-linked (PRKY) 10 ug
$300.00
RC210438L1 Lenti ORF clone of Human protein kinase, Y-linked (PRKY), Myc-DDK-tagged 10 ug
$600.00
RC210438L2 Lenti ORF clone of Human protein kinase, Y-linked (PRKY), mGFP tagged 10 ug
$600.00
RC210438L3 Lenti ORF clone of Human protein kinase, Y-linked (PRKY), Myc-DDK-tagged 10 ug
$600.00
RC210438L4 Lenti ORF clone of Human protein kinase, Y-linked (PRKY), mGFP tagged 10 ug
$600.00
RG210438 PRKY (tGFP-tagged) - Human protein kinase, Y-linked (PRKY) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC323404 PRKY (untagged)-Kinase deficient mutant (K78M) of Human protein kinase, Y-linked (PRKY) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.