BCL2 (NM_000633) Human Untagged Clone

CAT#: SC125546

Reviews ()
Write a review

BCL2 (untagged)-Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant alpha


Product Datasheet for 'SC125546'


 Cited in 9 publications.

  "NM_000633" in other vectors (6)

Need a mutant or fragment? Switch to a different vector? Get a free quote.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name BCL2 (NM_000633) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol BCL2
Synonyms Bcl-2; PPP1R50
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_000633, the custom clone sequence may differ by one or more nucleotides


GAATTCCCGGGATATCGTCGACCCACGCGTCCGCTGGAGAGTGCTGAAGATTGATGGGATCGTTGCCTTA
TGCATTTGTTTTGGTTTTACAAAAAGGAAACTTGACAGAGGATCATGCTGTACTTAAAAAATACAACATC
ACAGAGGAAGTAGACTGATATTAACAATACTTACTAATAATAACGTGCCTCATGAAATAAAGATCCGAAA
GGAATTGGAATAAAAATTTCCTGCATCTCATGCCAAGGGGGAAACACCAGAATCAAGTGTTCCGCGTGAT
TGAAGACACCCCCTCGTCCAAGAATGCAAAGCACATCCAATAAAATAGCTGGATTATAACTCCTCTTCTT
TCTCTGGGGGCCGTGGGGTGGGAGCTGGGGCGAGAGGTGCCGTTGGCCCCCGTTGCTTTTCCTCTGGGAA
GGATGGCGCACGCTGGGAGAACGGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCT
GTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCG
GGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCT
CGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGT
CCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCC
AGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGG
ACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAA
CCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCAC
ACCTGGATCCAGGATAACGGAGGCTGGGATGCCTTTGTGGAACTGTACGGCCCCAGCATGCGGCCTCTGT
TTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGG
TGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCA
GTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACA
CACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGTCTTCAGGCAAAACGT
CGAATCAGCTATTTACTGCCAAAGGGAAA


>OriGene 5' read for NM_000633 unedited
NGTTCACGTTAAAATTTGTAATAGACTCACTATAGGCGGCCGCGNAATCAGATCTGGTAC
CGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGCTGGAGAGTGCTGAAGATTG
ATGGGATCGTTGCCTTATGCATTTGTTTTGGTTTTACAAAAAGGAAACTTGACAGAGGAT
TCATGCTGTACTTAAAAAATACAACATCACAGAGGAAGTAGACTGATATTAACAATACTT
ACTAATAATAACGTGCCTCATGAAATAAAGATCCGAAAGGAATTGGAATAAAAATTTCCT
GCATCTCATGCCAAGGGGGAAACACCAGAATCAAGTGTTCCGCGTGATTGAAGACACCCC
CTCGTCCAAGAATGCAAAGCACATCCAATAAAATAGCTGGATTATAACTCCTCTTCTTTC
TCTGGGGGCCGTGGGGTGGGAGCTGGGGCGAGAGGTGCCGTTGGCCCCCGTTGCTTTTCC
TCTGGGAAGGATGGCGCACGCTGGGAGAACGGGGTACGATAACCGGGAGATAGTGATGAA
GTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCCGGAGAATGTTGGCG
CCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGC
CCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCCGCTG
CCCNCGGCGCGGCCGCGGGGGCCTGCGCTCAGCCCGGTGCCACCCTGTGTCCACCTGACC
CTCGCCAGCCNGCGACGACTTCTCCGCCGCTACCGCCGCGACTTCGCCGAGATGTTCAGC
CAGCTGCACCTGACGCCTTTACCGCGCCGGGGACGCTTTGCACCGTGGGGTGGAAGAGCT
CTTCAGGNACGGGGTG
>OriGene 3' read for NM_000633 unedited
CTGGGCCATTGGNGATGGCAACTTCCAGGNCCAGNAAAGCACTGGGGNAGGGTCACAGGN
ATGCCACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCCCTTTTTTTTTTTTT
TTAATGCCCCAGGATGTACAGATAACCCCCATATTCCACACCTGGAACTTTTTTTTTGTC
AGGTTTTCAAATAAAACCAAACTACAGTGACAAGATAATGTTTTACATGTAATTCCATAG
ACAGGGGTCAATTAATCCATGACACCTCACTTCAATGCTTCTTTTAGGATTTGTGACCCT
CTCCAAAGTCATTTAAAGCCTTGCTTTAAACTCACAGGTGGGCCAAGGCCACACAGCCAA
CGTGCCATGTGCTACAGCCAAAATGGGCCGTGGCCATTGCCTCTCCTCACGTTCCCAGCC
TTCACCATGTCCTTCTGATAGGAAGGGCCCAGGGCCTCTGTTCCTTCCCTCTACAGTGAT
ACATGTCTTAAGAAGGGTCGTGGCTCCCATGCTCCACGTGAAAACGGGCCTACCTGGAGG
GCCCCAGGGTGACAGGCCCAGCCACACCCCTCTACTGCTCTTTCTTGACAGTGGAATTCT
GAGCTCCATCAGCTTCCAGACATTCGGAGACCACACTGCCCTGTTGATCATCCCTGGAGG
AGGCCAGTGAGGGCCCCGGCTCAGTTCCAGGACCAGGCCTCCAAGCTGGGACACAGGCAG
GTTCTGCGGACTTCGGTCTCCTAAAACAGGCACTTGTGGCGGCCTGATGCTCTGGGTAAC
TCTAGCCTTCCTGATGCGGAAGTCACCGAAATGTTCACTTCCTCAAGTTCCAGAGGATTC
TGTTTCTTACTCAGACAGAGCCAGTATTGGGAGTTGGGGGGGGTGCGTATCCAAAATATA
TGAATATACACAATCG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_000633
Insert Size 3050 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000633.2, NP_000624.2
RefSeq Size 6492 bp
RefSeq ORF 720 bp
Locus ID 596
Cytogenetics 18q21.33
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane
Protein Pathways Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Focal adhesion, Neurotrophin signaling pathway, Pathways in cancer, Prostate cancer, Small cell lung cancer
Gene Summary This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (alpha) represents the longer transcript and encodes the longer isoform (alpha).

Citations (9)

Other Versions

Other products for "BCL2"
Frequently bought together (2)
BCL2 mouse monoclonal antibody, clone OTI9D3 (formerly 9D3)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools