ALG1 (NM_019109) Human Untagged Clone

CAT#: SC122883

Reviews ()
Write a review

ALG1 (untagged)-Human asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) (ALG1)



  "NM_019109" in other vectors (4)

USD 433.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name ALG1 (NM_019109) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol ALG1
Synonyms CDG1K; hMat-1; HMAT1; HMT-1; HMT1; Mat-1; MT-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_019109 edited
ACTGCTGCGGGCCAGCCAAGATGGCGGCCTCATGCTTGGTCCTGCTGGCGCTGTGTCTGC
TGCTGCCGCTGCTGCTGCTGGGAGGATGGAAGCGCTGGCGCCGGGGGCGGGCGGCCCGGC
ATGTAGTAGCGGTGGTGCTGGGCGACGTGGGCCGCAGCCCCCGTATGCAGTACCACGCGC
TGTCGTTGGCCATGCACGGCTTCTCGGTGACCCTCCTGGGGTTCTGCAACTCCAAACCCC
ATGATGAGCTCTTGCAGAACAACAGAATTCAGATTGTGGGGTTGACAGAACTTCAGAGTC
TTGCAGTTGGGCCCCGAGTTTTCCAGTACGGAGTCAAAGTTGTACTTCAGGCTATGTACT
TGCTGTGGAAGTTGATGTGGAGGGAGCCAGGTGCCTATATCTTTCTCCAGAACCCCCCAG
GTCTGCCTAGCATTGCTGTCTGCTGGTTCGTGGGCTGCCTTTGTGGAAGCAAGCTCGTCA
TTGACTGGCACAACTATGGCTACTCCATCATGGGTCTGGTGCATGGCCCCAACCATCCCC
TCGTTCTGCTGGCCAAGTGGTACGAGAAGTTCTTTGGGCGCCTGTCCCACCTGAACCTGT
GTGTTACCAATGCTATGCGAGAAGACCTGGCGGATAACTGGCACATCAGGGCTGTGACCG
TCTACGACAAGCCCGCATCTTTCTTTAAAGAGACACCTCTGGACCTGCAGCACCGGCTCT
TCATGAAGCTGGGCAGCATGCACTCTCCGTTCAGGGCCCGCTCAGAACCTGAGGACCCAG
TCACGGAGCGGTCGGCCTTCACGGAGCGGGATGCTGGGAGCGGGCTGGTGACGCGTCTCC
GTGAGCGGCCAGCCCTGCTGGTCAGCAGCACGAGCTGGACAGAGGACGAAGACTTCTCCA
TCCTGCTGGCAGCTTTAGAAAAGTTTGAACAACTGACTCTTGATGGACACAACCTTCCTT
CTCTCGTCTGTGTGATAACAGGCAAAGGGCCTATGAGGGAGTATTATAGCCGCCTCATCC
ACCAGAAGCACTTCCAGCACATCCAGGTCTGCACCCCCTGGCTGGAGGCCGAGGACTACC
CCCTGCTTCTAGGGTCGGCGGACCTGGGTGTCTGTCTGCACACGTCCTCCAGTGGCCTGG
ACCTGCCCATGAAGGTGGTGGACATGTTCGGGTGCTGTTTGCCTGTGTGTGCTGTGAACT
TCAAGTGTTTACATGAGCTGGTGAAACATGAAGAAAATGGCCTGGTCTTTGAGGACTCAG
AGGAACTGGCAGCTCAGCTGCAGATGCTTTTCTCAAACTTTCCTGATCCTGCGGGCAAGC
TAAACCAGTTCCGGAAGAACCTGCGGGAGTCGCAGCAGCTCCGATGGGATGAGAGCTGGG
TGCGGACTGTGCTCCCTTTGGTTATGGACACATAACTCCTGGGCCAGAGGCTATAAAACC
CCAGGACCCCTGCTGTCCTTCCCGCAGCTTCTTCTTGGAGTCTCAGGGCAAACCCTTTCG
AGCAGCACCTCCCAGTGGCCAGAAGCTGAAATGACAGCAGTGGTACTACCTGGTAAAAGA
ATTGGTTCTGTGACCCGGGAAGCTTTGGTTGGCCTTGATTTCTTCTCTGGAGGCTTGGAA
ACGCTTCCTCTCTTCTTCTGTTCTTCACGCCCCATGCCCCTGCTAGCGTATTACTGTTCT
GTGACTTCCCTGTGACCTCTGCAGAACTCCTCATCCTGCGTTTGGTCTCCAGGTGTCCCC
TTTCTGCCGTGTTCCTAACATTTTGATTCCTGTCTTGAAAAAAGCACCTGCTGCACCGTA
AGCCCAGGGATGTGGCAGCTGCAGTGGGCTTGGCTTTGTGAGGAACTGAGTGTGTCCACG
TTGGGGGAACATCATACTTGATACACACGTTTTTATTTGCACAAAGAAAATGCTATTTTT
GGAGCCAGAATTTTCATGTCTGATTTATGGTGATTTTCTTAAGAACCAGAACTGCTGGCA
GAAAGGGGGCACCCACACGCTTAGATAGCCGATGTCTTATTAGAGGGCAGTTTGTGGTTC
CTGATTTGGAAATTAACATTCTCCAAACATTCCAGTCCAATGAAAGTTTTATCCGCTTTC
CCATATAAAAATTCTTCCCACGAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_019109 unedited
NNGGAGTTCACATTTGTATACGACTCATATAGGCGGCCGCATAACTTCGTATAGCATACA
TTATACGAAGTTATGGATCAGGCCAAATCGGCCGAGCTCGAATTCGTCGAGAGCGGACTG
CTGCGGGCCAGCCAAGATGGCGGCCTCATGCTTGGTCCTGCTGGCGCTGTGTCTGCTGCT
GCCGCTGCTGCTGCTGGGAGGATGGAAGCGCTGGCGCCGGGGGCGGGCGGCCCGGCATGT
AGTAGCGGTGGTGCTGGGCGACGTGGGCCGCAGCCCCCGTATGCAGTACCACGCGCTGTC
GTTGGCCATGCACGGCTTCTCGGTGACCCTCCTGGGGTTCTGCAACTCCAAACCCCATGA
TGAGCTCTTGCAGAACAACAGAATTCAGATTGTGGGGTTGACAGAACTTCAGAGTCTTGC
AGTTGGGCCCCGAGTTTTCCAGTACGGAGTCAAAGTTGTACTTCAGGCTATGTACTTGCT
GTGGAAGTTGATGTGGAGGGAGCCAGGTGCCTATATCTTTCTCCAGAACCCCCCAGGTCT
GCCTAGCATTGCTGTCTGCTGGTTCGTGGGCTGCCTTTGTGGAAGCAAGCTCGTCATTGA
CTGGCACAACTATGGCTACTCCATCATGGGTCTGGTGCATGGCCCCAACCATCCCCTCGT
TCTGCTGGCCAAGTGGTACGAGAAGTTCTTTGGGCGCCTGTCCCACCTGAACCTGTGTGT
TACCAATGCTATGCGAGAAGACCTGGCGGATAACTGGCACATCAAGGCTGTGACCGTCTA
CGACAAGCCGCATCTTTCTTTAAGAGACACCTCTGGACTGCAGCACCGGCTCTTCATGAG
CTGGGCANCATGCACTCTCCGTTCAGGGCCCGCTAG
Restriction Sites Please inquire     
ACCN NM_019109
Insert Size 2100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019109.3, NP_061982.3
RefSeq Size 2149 bp
RefSeq ORF 1395 bp
Locus ID 56052
Cytogenetics 16p13.3
Protein Families Transmembrane
Protein Pathways Metabolic pathways, N-Glycan biosynthesis
Gene Summary The enzyme encoded by this gene catalyzes the first mannosylation step in the biosynthesis of lipid-linked oligosaccharides. This gene is mutated in congenital disorder of glycosylation type Ik. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

Other products for "ALG1"
Frequently bought together (2)
Rabbit polyclonal Anti-ALG1 Antibody
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools