METTL11A (NTMT1) (NM_014064) Human Untagged Clone

SKU
SC120836
NTMT1 (untagged)-Human methyltransferase like 11A (METTL11A)
$300.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol METTL11A
Synonyms AD-003; C9orf32; HOMT1A; METTL11A; NRMT; NRMT1; NTM1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_014064, the custom clone sequence may differ by one or more nucleotides


ATGACGAGCGAGGTGATAGAAGACGAGAAGCAATTCTATTCCAAGGCCAAGACCTACTGGAAACAAATCC
CACCCACGGTGGACGGCATGCTTGGGGGGTATGGCCACATCTCCAGCATCGACATCAACAGCTCCCGGAA
GTTTCTGCAGAGGTTTTTGAGGGAAGGCCCGAACAAGACAGGAACGTCCTGTGCCCTGGACTGTGGAGCT
GGCATTGGGAGGATCACCAAGCGGCTGCTCCTGCCGCTGTTCAGAGAGGTGGATATGGTCGACATAACGG
AGGACTTCCTGGTTCAAGCCAAGACCTACCTGGGGGAGGAGGGCAAGAGGGTGAGGAACTACTTCTGTTG
TGGGCTCCAGGACTTCACCCCGGAGCCGGACTCTTACGACGTGATCTGGATCCAGTGGGTGATAGGCCAC
CTCACCGATCAGCACCTGGCCGAGTTCCTGCGGCGCTGCAAGGGCAGCCTCCGCCCCAACGGCATCATCG
TCATCAAAGACAACATGGCCCAGGAGGGCGTGATTCTGGACGACGTGGACAGCAGCGTGTGCCGGGACCT
TGACGTGGTCCGCAGGATCATCTGCAGTGCAGGCCTCAGCCTCCTGGCCGAGGAGAGGCAGGAGAACCTC
CCCGATGAGATCTACCATGTCTATAGCTTTGCCCTGAGATGA


Restriction Sites Please inquire
ACCN NM_014064
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014064.2, NP_054783.2
RefSeq Size 1007 bp
RefSeq ORF 672 bp
Locus ID 28989
UniProt ID Q9BV86
Cytogenetics 9q34.11
Protein Families Druggable Genome
Summary The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 5 all encode isoform a.
Write Your Own Review
You're reviewing:METTL11A (NTMT1) (NM_014064) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200055 NTMT1 (Myc-DDK-tagged)-Human methyltransferase like 11A (METTL11A) 10 ug
$300.00
RC200055L3 Lenti ORF clone of Human methyltransferase like 11A (METTL11A), Myc-DDK-tagged 10 ug
$600.00
RC200055L4 Lenti ORF clone of Human methyltransferase like 11A (METTL11A), mGFP tagged 10 ug
$600.00
RG200055 NTMT1 (tGFP-tagged) - Human methyltransferase like 11A (METTL11A) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.