ROMO1 (NM_080748) Human Untagged Clone

SKU
SC120357
ROMO1 (untagged)-Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ROMO1
Synonyms bA353C18.2; C20orf52; MTGM; MTGMP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC120357 sequence for NM_080748 edited (data generated by NextGen Sequencing)
ATGCCGGTGGCCGTGGGTCCCTACGGACAGTCCCAGCCAAGCTGCTTCGACCGTGTCAAA
ATGGGCTTCGTGATGGGTTGCGCCGTGGGCATGGCGGCCGGGGCGCTCTTCGGCACCTTT
TCCTGTCTCAGGATCGGAATGCGGGGTCGAGAGCTGATGGGCGGCATTGGGAAAACCATG
ATGCAGAGTGGCGGCACCTTTGGCACATTCATGGCCATTGGGATGGGCATCCGATGCTAA

Clone variation with respect to NM_080748.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_080748 unedited
NGGGGTTTANATTTGTATACAATTATATAGGCGGCCGCGAAATTCGCACCAGTAGAGCTG
AGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACGGACAGTCC
CAGCCAAGCTGCTTCGACCGTGTCAAAATGGGCTTCGTGATGGGTTGCGCCGTGGGCATG
GCGGCCGGGGCGCTCTTCGGCACCTTTTCCTGTCTCAGGATCGGAATGCGGGGTCGAGAG
CTGATGGGCGGCATTGGGAAAACCATGATGCAGAGTGGCGGCACCTTTGGCACATTCATG
GCCATTGGGATGGGCATCCGATGCTAACCATGGTTGCCAACTACATCTGTCCCTTCCCAT
CAATCCCAGCCCATGTACTAATAAAAGAAAGTCTTTGAGTAAAAAAAAAAAAAAAAAAAA
AAAAAACTCGAGACTAGCTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATC
CCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTC
CAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGT
CCTTCTATATATTATGGGGTGAGGGGGTGGGGTTTTTGAACCAAGGGGCAAAGTTGGGAA
GACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATC
TTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGA
GTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAG
ACGGGGTTTCACCATATTGGGCCAGCTGGTCTCCACTNCTAATCTCAGTGATCTACCACC
TTNGGCTNNCAATGCTGGGATACAGGCGTGA
Restriction Sites NotI-NotI
ACCN NM_080748
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_080748.1, NP_542786.1
RefSeq Size 602 bp
RefSeq ORF 240 bp
Locus ID 140823
UniProt ID P60602
Cytogenetics 20q11.22
Protein Families Transmembrane
Summary The protein encoded by this gene is a mitochondrial membrane protein that is responsible for increasing the level of reactive oxygen species (ROS) in cells. The protein also has antimicrobial activity against a variety of bacteria by inducing bacterial membrane breakage. [provided by RefSeq, Nov 2014]
Write Your Own Review
You're reviewing:ROMO1 (NM_080748) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210655 ROMO1 (Myc-DDK-tagged)-Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein 10 ug
$150.00
RC210655L1 Lenti ORF clone of Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$450.00
RC210655L2 Lenti ORF clone of Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$450.00
RC210655L3 Lenti ORF clone of Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$450.00
RC210655L4 Lenti ORF clone of Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$450.00
RG210655 ROMO1 (tGFP-tagged) - Human reactive oxygen species modulator 1 (ROMO1), nuclear gene encoding mitochondrial protein 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.