alpha Synuclein(SNCA) (NM_000345) Human Untagged Clone

CAT#: SC119919

SNCA (untagged)-Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name alpha Synuclein(SNCA) (NM_000345) Human Untagged Clone
Symbol SNCA
Synonyms NACP; PARK1; PARK4; PD1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119919 sequence for NM_000345 edited (data generated by NextGen Sequencing)
ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAG
AAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTA
GGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAA
GAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAG
ACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTG
GGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCT
GACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCC
TAA

Clone variation with respect to NM_000345.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000345 unedited
GGTCGAATTTGTATACGACTCCTATAGGCGGCCCGCGAATTCGCACGAGGAAGGGGCCCA
AGAGAGGGGGCGAGCGACCGAGCGCCGCGACGCGGAAGTGAGGTGCGTGCGGGCTGCAGC
GCAGACCCCGGCCCGGCCCCTCCGAGAGCGTCCTGGGCGCTCCCTCACGCCTTGCCTTCA
AGCCTTCTGCCTTTCCACCCTCGTGAGCGGAGAACTGGGAGTGGCCATTCGACGACAGTG
TGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGG
AGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGA
CAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGG
CAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGG
GTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTG
GCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTC
TGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGT
ATCAAGACTACGAACCTGAAGCCTAAGAAATATCTTTGCTCCCAGTTTCTTGAGATCTGC
TGACAGATGTTCCATCCTGTACAAGTGCTCAGTTCCAATGTGCCCAGTCATGACATTTCT
CANAGTTTTTACAGTGTATCTCGAAAGTCTTCATCAGCAGTGATTGAAGTATCTGCACCT
GCCCNCACTCAGCATTNNCGTGCTTCCCTTTCACTGNAGTGAATACATGGTAGCAGGTCC
TTGTGTGCTGTGGATTNTGTGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000345 unedited
GATGGAACCTCCATTGCCAGNANAGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGAT
CTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGNNTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTATTTTGGCAATGAAATAACGTTTTATTTTAATTC
TCACCATTTATATACAAACCCAAGTGAATTATTCACATCGCAAAAGGGGAAAATTTCATA
TTTAGTATTTATAGGGGCATAGTTTCATGCTCACATATTTTTAAGTTTTATATATTTTAA
CAAATTTCACAATACGTCATTTTTCTTAAACAGTTTCATTAAAAGACACCTAAAAATCTT
ATAATATATGATAGCAAATCACTAACAACTTTTGAACAACAGCAACAAAAAAATAGGGGG
GATTTAAAAATAAGGGGGAGCCACTTAGGGGTTTTTAATTTGTTTTAACATCGTAGATTG
AAGCCACAAAATCCACAGCACACAAAGACCCTGCTACCATGTATTCACTTCAGGGAAAGG
GAACCACCGAAATGCTGAGTGGGGGCAGGTACAAATACTTCAATCACTGGTGATGGAAGA
CTTCGAGATACACTGTAAAAACTTTGAGAAATGTCATGACTGGGCACATTGGAACTGAGC
ACTTGTACAGTATGGAACATCTGTCAACAGATCTCAAAAAACTGGGAGCAAAGATATTTC
TTAGGCTTCAGGTTCGGAGTCTTGATACCCTTCCTCAAAAGGCATTTCATAAGCCTTATT
GTCAGGATACACAAGCATTTTTTTCCAAAATTCCTTCCTGTGGGGGCTCCTTCTTAATAC
TTTGACAAACTGTTCTTTTTTGACAAAGCCAGGGGCTGTTGGAATGCTTCCTGCTCCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000345
ORF Size 423 bp
Insert Size 1330
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000345.2, NP_000336
RefSeq Size 1543
Locus ID 6622
Cytogenetics 4q22.1
Domains Synuclein
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Parkinson's disease
Gene Summary May be involved in the regulation of dopamine release and transport. Induces fibrillization of microtubule-associated protein tau. Reduces neuronal responsiveness to various apoptotic stimuli, leading to a decreased caspase-3 activation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1, also known as NACP140) is the longest transcript and encodes the longer isoform (NACP140). Variants 1, 2, and 3 all encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations