alpha Synuclein (SNCA) (NM_000345) Human Untagged Clone

CAT#: SC119919

Reviews ()
Write a review

SNCA (untagged)-Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1



Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product images

Other products for "SNCA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SNCA
Synonyms NACP; PARK1; PARK4; PD1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC119919 sequence for NM_000345 edited (data generated by NextGen Sequencing)
ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAG
AAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTA
GGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAA
GAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAG
ACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTG
GGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCT
GACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCC
TAA

Clone variation with respect to NM_000345.3
>OriGene 5' read for NM_000345 unedited
GGTCGAATTTGTATACGACTCCTATAGGCGGCCCGCGAATTCGCACGAGGAAGGGGCCCA
AGAGAGGGGGCGAGCGACCGAGCGCCGCGACGCGGAAGTGAGGTGCGTGCGGGCTGCAGC
GCAGACCCCGGCCCGGCCCCTCCGAGAGCGTCCTGGGCGCTCCCTCACGCCTTGCCTTCA
AGCCTTCTGCCTTTCCACCCTCGTGAGCGGAGAACTGGGAGTGGCCATTCGACGACAGTG
TGGTGTAAAGGAATTCATTAGCCATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGG
AGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGA
CAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGG
CAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGG
GTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTG
GCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTC
TGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGT
ATCAAGACTACGAACCTGAAGCCTAAGAAATATCTTTGCTCCCAGTTTCTTGAGATCTGC
TGACAGATGTTCCATCCTGTACAAGTGCTCAGTTCCAATGTGCCCAGTCATGACATTTCT
CANAGTTTTTACAGTGTATCTCGAAAGTCTTCATCAGCAGTGATTGAAGTATCTGCACCT
GCCCNCACTCAGCATTNNCGTGCTTCCCTTTCACTGNAGTGAATACATGGTAGCAGGTCC
TTGTGTGCTGTGGATTNTGTGC
>OriGene 3' read for NM_000345 unedited
GATGGAACCTCCATTGCCAGNANAGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGAT
CTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGNNTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTATTTTGGCAATGAAATAACGTTTTATTTTAATTC
TCACCATTTATATACAAACCCAAGTGAATTATTCACATCGCAAAAGGGGAAAATTTCATA
TTTAGTATTTATAGGGGCATAGTTTCATGCTCACATATTTTTAAGTTTTATATATTTTAA
CAAATTTCACAATACGTCATTTTTCTTAAACAGTTTCATTAAAAGACACCTAAAAATCTT
ATAATATATGATAGCAAATCACTAACAACTTTTGAACAACAGCAACAAAAAAATAGGGGG
GATTTAAAAATAAGGGGGAGCCACTTAGGGGTTTTTAATTTGTTTTAACATCGTAGATTG
AAGCCACAAAATCCACAGCACACAAAGACCCTGCTACCATGTATTCACTTCAGGGAAAGG
GAACCACCGAAATGCTGAGTGGGGGCAGGTACAAATACTTCAATCACTGGTGATGGAAGA
CTTCGAGATACACTGTAAAAACTTTGAGAAATGTCATGACTGGGCACATTGGAACTGAGC
ACTTGTACAGTATGGAACATCTGTCAACAGATCTCAAAAAACTGGGAGCAAAGATATTTC
TTAGGCTTCAGGTTCGGAGTCTTGATACCCTTCCTCAAAAGGCATTTCATAAGCCTTATT
GTCAGGATACACAAGCATTTTTTTCCAAAATTCCTTCCTGTGGGGGCTCCTTCTTAATAC
TTTGACAAACTGTTCTTTTTTGACAAAGCCAGGGGCTGTTGGAATGCTTCCTGCTCCA
Restriction Sites NotI-NotI     
ACCN NM_000345
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000345.2, NP_000336.1
RefSeq Size 1543 bp
RefSeq ORF 423 bp
Locus ID 6622
UniProt ID P37840
Cytogenetics 4q22.1
Domains Synuclein
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Parkinson's disease
Gene Summary Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1, also known as NACP140) is the longest transcript and encodes the longer isoform (NACP140). Variants 1, 2, and 3 all encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.