BIRC5 (NM_001168) Human Untagged Clone
SKU
SC119405
BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | BIRC5 |
Synonyms | API4; EPR-1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_001168 edited
ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG AAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC ATGGATTGA |
Restriction Sites | Please inquire |
ACCN | NM_001168 |
Insert Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001168.2, NP_001159.2 |
RefSeq Size | 2655 bp |
RefSeq ORF | 429 bp |
Locus ID | 332 |
UniProt ID | O15392 |
Cytogenetics | 17q25.3 |
Domains | BIR |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Colorectal cancer, Pathways in cancer |
Summary | This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (1) represents the most frequently occurring transcript and it encodes isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC205935 | BIRC5 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1 | 10 ug |
$225.00
|
|
RC205935L1 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, Myc-DDK-tagged | 10 ug |
$525.00
|
|
RC205935L2 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, mGFP tagged | 10 ug |
$525.00
|
|
RC205935L3 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, Myc-DDK-tagged | 10 ug |
$525.00
|
|
RC205935L4 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, mGFP tagged | 10 ug |
$525.00
|
|
RG205935 | BIRC5 (tGFP-tagged) - Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1 | 10 ug |
$425.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.