OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BIRC5 (NM_001168) Human Untagged Clone

Be the first to review this product
SKU
SC119405
BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA501245 Anti-BIRC5/Survivin mouse monoclonal antibody, clone OTI2D9 (formerly 2D9) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BIRC5 or NM_001168"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BIRC5
Synonyms API4; EPR-1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001168 edited
ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT
ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG
GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC
TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCAT
TCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAA
TTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAG
AAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCC
ATGGATTGA
Restriction Sites Please inquire |
ACCN NM_001168
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001168.2, NP_001159.2
RefSeq Size 2655 bp
RefSeq ORF 429 bp
Locus ID 332
UniProt ID O15392
Cytogenetics 17q25.3
Domains BIR
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Colorectal cancer, Pathways in cancer
Summary This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. provided by RefSeq, Jun 2011
Transcript Variant: This variant (1) represents the most frequently occurring transcript and it encodes isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001168" in other vectors (6)
SKU Description Size Price
RC205935 BIRC5 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1 10 ug
$225.00
RC205935L1 Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, Myc-DDK-tagged 10 ug
$525.00
RC205935L2 Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, mGFP tagged 10 ug
$525.00
RC205935L3 Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, Myc-DDK-tagged 10 ug
$525.00
RC205935L4 Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 1, mGFP tagged 10 ug
$525.00
RG205935 BIRC5 (tGFP-tagged) - Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 1 10 ug
$425.00

file-alt Citations

BIRC5/Survivin is a novel ATG12-ATG5 conjugate interactor and an autophagy-induced DNA damage suppressor in human cancer and mouse embryonic fibroblast cells
Lin, Chan, Chen et al
Autophagy (2019)
AI Summary: In this study, OriGene products including the BIRC5/Survivin shRNA (TL311386), ATG7 shRNA (TL312101), and SQSTM1/p62 antibody (TA500122) were used to specifically knock down gene expression and detect protein levels, enabling the authors to investigate the role of BIRC5/Survivin in regulating autophagy and DNA damage suppression in cancer and mouse embryonic fibroblast cells.
Snippet: ABSTRACTBIRC5/Survivin is known as a dual cellular functions protein that directly regulates both apoptosis and mitosis in embryonic cells during embryogenesis and in cancer cells during tumorigene
IP
Overexpression of miR-214-3p in esophageal squamous cancer cells enhances sensitivity to cisplatin by targeting survivin directly and indirectly through CUG-BP1
Phatak, Byrnes, Mansour et al
Oncogene (2015)
Cited by 93
AI Summary: OriGene’s pCMV6-XL5 plasmids containing CUG-BP1 or survivin cDNA were used to transiently overexpress these genes in TE7 esophageal cancer cells, enabling the authors to assess their roles in miR-214-3p-mediated regulation and chemoresistance.
Snippet: To transiently overexpress CUG-BP1 and survivin, TE7 cells were transfected with 2 μg of pCMV6-XL5 plasmid containing CUG-BP1 or survivin cDNA (OriGene, Rockville, MD, USA) diluted in 500 μl Opti-MEM I containing 5 μl Lipofectamine 2000 (Invitrogen). ... Cite SaveSaving
Synergistic Induction of Erlotinib-Mediated Apoptosis by Resveratrol in Human Non-Small-Cell Lung Cancer Cells by Down-Regulating Survivin and Up-Regulating PUMA
Nie, Hu, Zhang et al
Cell. Physiol. Biochem. (2015) 35 (6), 2255-2271 DOI: 10.1159/000374030
Cited by 79
AI Summary: OriGene contributed to this study by providing the survivin overexpression plasmid (PCMV6XL4), which was used to investigate the role of survivin in apoptosis in non-small-cell lung cancer cells treated with resveratrol and erlotinib.
Snippet: GenePharma Co.. For PUMA: 5′-GAGCGGCGGAGACAAGAAGA GUU-3′;Plasmid transient transfection. The survivin and control plasmid DNA (PCMV6XL4) used in this study were obtained from OriGene (Rockville). For transient ... Cite SaveSaving
cIAP1 stability contributes to YM155 resistance in human gastric cancer cells
Jung, Park, Hong et al
J. Biol. Chem. (2015)
AI Summary: OriGene contributed to this study by providing survivin and cIAP1 cDNA plasmids, which were used to investigate how altering the expression of these proteins affects gastric cancer cell sensitivity to YM155.
Snippet: activated cell sorter (Becton Dickson, San Jose, CA, USA). Plasmids, siRNAs and transfections - Survivin and cIAP1 cDNAs were purchased from Origene (Rockville, MD, USA). Survivin T34A, C84A, T34A/C84A or cIAP1 H588A ... Cite SaveSaving
Survivin transcript variant 2 drives angiogenesis and malignant progression in proneural gliomas
Doucette, Latha, Yang et al
Neuro-oncology (2014)
Cited by 13
AI Summary: OriGene Technologies contributed pCMV6-XL4 plasmids containing human survivin variant 1 (NM_001168.2) and variant 2 (NM_001012270.1) cDNA, which were used to study the effects of survivin isoforms on glioma formation and progression in vivo.
Snippet: The details of RCAS-platelet-derived growth factor subunit B (PDGFB) construction were described by Dai et al. 22 pCMV6-XL4 plasmids containing human survivin variant 1 (NM_001168.2) or variant 2 (NM_001012270.1) cDNA were obtained from OriGene Technologies ... Cite SaveSaving
Sorafenib overcomes TRAIL resistance of hepatocellular carcinoma cells through the inhibition of STAT3
Chen, Tai, Liu et al
Clin Cancer Res (2010) 16 (21), 5189-99 DOI: 10.1158/1078-0432.CCR-09-3389
AI Summary: In this study, OriGene’s STAT3 shRNA (sc-29493) and STAT3 expression plasmid (RC210307) were used to manipulate STAT3 levels in hepatocellular carcinoma cells, helping to demonstrate that STAT3 inhibition is key to overcoming TRAIL resistance with sorafenib treatment.
Showing 1-6 of 6 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products