CD153 (TNFSF8) (NM_001244) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CD153 |
Synonyms | CD30L; CD30LG; CD153; TNLG3A |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001244, the custom clone sequence may differ by one or more nucleotides
ATGGACCCAGGGCTGCAGCAAGCACTCAACGGAATGGCCCCTCCTGGAGACACAGCCATGCATGTGCCGG CGGGCTCCGTGGCCAGCCACCTGGGGACCACGAGCCGCAGCTATTTCTATTTGACCACAGCCACTCTGGC TCTGTGCCTTGTCTTCACGGTGGCCACTATTATGGTGTTGGTCGTTCAGAGGACGGACTCCATTCCCAAC TCACCTGACAACGTCCCCCTCAAAGGAGGAAATTGCTCAGAAGACCTCTTATGTATCCTGAAAAGGGCTC CATTCAAGAAGTCATGGGCCTACCTCCAAGTGGCAAAGCATCTAAACAAAACCAAGTTGTCTTGGAACAA AGATGGCATTCTCCATGGAGTCAGATATCAGGATGGGAATCTGGTGATCCAATTCCCTGGTTTGTACTTC ATCATTTGCCAACTGCAGTTTCTTGTACAATGCCCAAATAATTCTGTCGATCTGAAGTTGGAGCTTCTCA TCAACAAGCATATCAAAAAACAGGCCCTGGTGACAGTGTGTGAGTCTGGAATGCAAACGAAACACGTATA CCAGAATCTCTCTCAATTCTTGCTGGATTACCTGCAGGTCAACACCACCATATCAGTCAATGTGGATACA TTCCAGTACATAGATACAAGCACCTTTCCTCTTGAGAATGTGTTGTCCATCTTCTTATACAGTAATTCAG ACTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001244 unedited
GTACAGTCAGATTTGTAAACGACTCACTATAGGCGGCCGCGAATTCGCACGAGTGGAGAC ACAGCCATGCATGTGCCGGCGGGCTCCGTGGCCAGCCACCTGGGGACCACGAGCCGCAGC TATTTCTATTTGACCACAGCCACTCTGGCTCTGTGCCTTGTCTTCACGGTGGCCACTATT ATGGTGTTGGTCGTTCAGAGGACGGACTCCATTCCCAACTCACCTGACAACGTCCCCCTC AAAGGAGGAAATTGCTCAGAAGACCTCTTATGTATCCTGAAAAGGGCTCCATTCAAGAAG TCATGGGCCTACCTCCAAGTGGCAAAGCATCTAAACAAAACCAAGTTGTCTTGGAACAAA GATGGCATTCTCCATGGAGTCAGATATCAGGATGGGAATCTGGTGATCCAATTCCCTGGT TTGTACTTCATCATTTGCCAACTGCAGTTTCTTGTACAATGCCCAAATAATTCTGTCGAT CTGAAGTTGGAGCTTCTCATCAACAAGCATATCAAAAAACAGGCCCTGGTGACAGTGTGT GAGTCTGGAATGCAAACGAAACACGTATACCAGAATCTCTCTCAATTCTTGCTGGATTAC CTGCAGGTCAACACCACCATATCAGTCAATGTGGATACATTCCAGTACATAGATACAAGC ACCTTTCCTCTTGAGAATGTGTTGTCCATCTTCTTATACAGTAATTCAGACTGAAACAGT TCTCTTGGCCTTCAGGAAGAAAGCGCCTCTCTACCATACAGTATTTCATCCCTCCAAACA CTTGGGCCAAAAGAAGACTTTTGACCAAGACAAACTACACAGGGTATTAAATAGTATACC TCTCCTTCTGTCTCTTGGAAAGATACAGCTCCAAGGTTAAAAAGAGAGTGTTTAGTG |
Restriction Sites | NotI-NotI |
ACCN | NM_001244 |
Insert Size | 2750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001244.2, NP_001235.1 |
RefSeq Size | 1979 bp |
RefSeq ORF | 705 bp |
Locus ID | 944 |
UniProt ID | P32971 |
Cytogenetics | 9q32-q33.1 |
Domains | TNF |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC211276 | TNFSF8 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8) | 10 ug |
$300.00
|
|
RC211276L1 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC211276L2 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), mGFP tagged | 10 ug |
$600.00
|
|
RC211276L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC211276L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), mGFP tagged | 10 ug |
$600.00
|
|
RG211276 | TNFSF8 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.