GFAP (NM_002055) Human Untagged Clone

CAT#: SC118873

GFAP (untagged)-Human glial fibrillary acidic protein (GFAP), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GFAP (NM_002055) Human Untagged Clone
Symbol GFAP
Synonyms ALXDRD
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118873 sequence for NM_002055 edited (data generated by NextGen Sequencing)
ATGGAGAGGAGACGCATCACCTCCGCTGCTCGCCGCTCCTACGTCTCCTCAGGGGAGATG
ATGGTGGGGGGCCTGGCTCCTGGCCGCCGTCTGGGTCCTGGCACCCGCCTCTCCCTGGCT
CGAATGCCCCCTCCACTCCCAACCCGGGTGGATTTCTCCCTGGCTGGGGCACTCAATGCT
GGCTTCAAGGAGACCCGGGCCAGTGAGCGGGCAGAGATGATGGAGCTCAATGACCGCTTT
GCCAGCTACATCGAGAAGGTTCGCTTCCTGGAACAGCAAAACAAGGCGCTGGCTGCTGAG
CTGAACCAGCTGCGGGCCAAGGAGCCCACCAAGCTGGCAGACGTCTACCAGGCTGAGCTG
CGAGAGCTGCGGCTGCGGCTCGATCAACTCACCGCCAACAGCGCCCGGCTGGAGGTTGAG
AGGGACAATCTGGCACAGGACCTGGCCACTGTGAGGCAGAAGCTCCAGGATGAAACCAAC
CTGAGGCTGGAAGCCGAGAACAACCTGGCTGCCTATAGACAGGAAGCAGATGAAGCCACC
CTGGCCCGTCTGGATCTGGAGAGGAAGATTGAGTCGCTGGAGGAGGAGATCCGGTTCTTG
AGGAAGATCCACGAGGAGGAGGTTCGGGAACTCCAGGAGCAGCTGGCCCGACAGCAGGTC
CATGTGGAGCTTGACGTGGCCAAGCCAGACCTCACCGCAGCCCTGAAAGAGATCCGCACG
CAGTATGAGGCAATGGCGTCCAGCAACATGCATGAAGCCGAAGAGTGGTACCGCTCCAAG
TTTGCAGACCTGACAGACGCTGCTGCCCGCAACGCGGAGCTGCTCCGCCAGGCCAAGCAC
GAAGCCAACGACTACCGGCGCCAGTTGCAGTCCTTGACCTGCGACCTGGAGTCTCTGCGC
GGCACGAACGAGTCCCTGGAGAGGCAGATGCGCGAGCAGGAGGAGCGGCACGTGCGGGAG
GCGGCCAGTTATCAGGAGGCGCTGGCGCGGCTGGAGGAAGAGGGGCAGAGCCTCAAGGAC
GAGATGGCCCGCCACTTGCAGGAGTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGAC
ATCGAGATCGCCACCTACAGGAAGCTGCTAGAGGGCGAGGAGAACCGGATCACCATTCCC
GTGCAGACCTTCTCCAACCTGCAGATTCGAGAAACCAGCCTGGACACCAAGTCTGTGTCA
GAAGGCCACCTCAAGAGGAACATCGTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTC
ATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGA

Clone variation with respect to NM_002055.4
141 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002055 unedited
GCCCCGTTGCCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTC
ATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATTCGG
CACGAGGGCAGGATGGAGAGGAGACGCATCACCTCCGCTGCTCGCCGCTCCTACGTCTCC
TCAGGGGAGATGATGGTGGGGGGCCTGGCTCCTGGCCGCCGTCTGGGTCCTGGCACCCGC
CTCTCCCTGGCTCGAATGCCCCCTCCACTCCCAACCCGGGTGGATTTCTCCCTGGCTGGG
GCACTCAATGCTGGCTTCAAGGAGACCCGGGCCAGTGAGCGGGCAGAGATGATGGAGCTC
AATGACCGCTTTGCCAGCTACATCGAGAAGGTTCGCTTCCTGGAACAGCAAAACAAGGCG
CTGGCTGCTGAGCTGAACCAGCTGCGGGCCAAGGAGCCCACCAAGCTGGCAGACGTCTAC
CAGGCTGAGCTGCGAGAGCTGCGGCTGCGGCTCGATCAACTCACCGCCAACAGCGCCCGG
CTGGAGGTTGAGAGGGACAATCTGGCACAGGACCTGGCCACTGTGAGGCAGAAGCTCCAG
GATGAAACCAACCTGAGGCTGGAAGCCGAGAACAACCTGGCTGCCTATAGACAGGAAGCA
GATGAAGCCACCCTGGCCCGTCTGGATCTGGAGAGGAAGATTGAGTCGCTGGAGGAGGAG
ATCCGGTTCTTGAGGAAGATCCACGANGAGGGAGGTCGGNAACTNCAGNAGCAGCTGGCC
CGACAGCNAGTCCATGTGGAGCTTGACGTGGCCAGCCAGACCTCACGCAGCCCTGAAAGA
GATCGCACGCAGTATGAGGGCATGGCGTCCAGCACATGCATGAAGCCCGAGAGTGTACCG
CTCCCAGTTGCAGACCTGACGACGCTGCTGNCCGCACGCGNAGCTGNTCCGCCAGGCCAG
CCACGAGCCACGACTACCGNGCCAGNTGCAGTCCTTGACTGCGACCTGNNATCTCTGCNC
GGNACAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002055 unedited
TTGGTCGCTGCCGCAATTTANATCGAGTTTTTTTTTTTTTTTTTTGAGGGCGCAGCATTT
GTCTTTATTTTTCCTCAGCGACTAAAGGCAGCAGCAGTGCCCTGAAGATTAGCAGCAGCA
GCAGCAGCAGGTGGCAGGAAGGAGTGGAGGGAAAGGACACCAAGTCTTGGGGAGAGGGAA
GGACCCTTCTTCGGCCTTAGAGGGGAGAGGAGAACCCTGAAGTGGGCCCTCCCAGTCCCA
TCTCTGGGCACAGATCCCACCAGTCTGCTCACCAGTCTGCTCAGTCAAAGCAGAGTGGGT
GCACTGGGGTGGACGTGTCAGCCCTGAGCACCCGGCCTCCAGGCTGCAGGAATATGAGCC
AGTGTCTTCACTTTGCTCGTGCCTCAGTTTTACAATTGTAAAATAGGGCACTACCTAGAA
TACTGGGTACATTTTGTGTGTGAGTAAGAAGGGACCGCAAGAGGCCCTTGGCTTAGGGAA
AAGCAGCCGGTCACTATGGGGTGGAGAGGGTCAGACGTGTGGCAGTGGCTTACTGGGGTT
AAGAAGCAGCAGTCCCAGGGGCTCAGAGGCTGGGGCGGCCTGGTATGACACAGCAAGGAA
GAGGCCTTTAGAAATGGGACAAAGTCATGCCCTGCCCCCATGGATACATCCCCTTTCTCT
CCTGTTTCAGCATCTTCAAGAGGATGAGTCACTTCCTTAATTCCCACAATCCAGAGGCCA
AGTGCAACTGGTCACCCACAACCCCTACTTGTATGCCTAGCGCCATCCCAATTGCCTCCT
CCTCCATCTCTACCAGCGTCCCCTCCAGTCTGCACGGGGCAGTCCTCCTGGGCTTGACCT
CTCTGTACCCACAGCTGGGGGCCAGGCAGCCCCCCTCTATCCCTCCCAGCACTNATCCCT
CTNCACGTACACCACAGATCCCCCCAGTGCTGAGAAATCAAGCTCCACCTGCCCACAGCG
TGCCCACAGATGGCATC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002055
ORF Size 1299 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002055.2, NP_002046
RefSeq Size 3035
Locus ID 2670
Cytogenetics 17q21.31
Domains filament, filament_head
Protein Families ES Cell Differentiation/IPS
Gene Summary This gene encodes one of the major intermediate filament proteins of mature astrocytes. It is used as a marker to distinguish astrocytes from other glial cells during development. Mutations in this gene cause Alexander disease, a rare disorder of astrocytes in the central nervous system. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008].
Transcript Variant: This variant (1) represents the longest transcript and encodes a predominant isoform (1, also known as alpha).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations