GAPDH (NM_002046) Human Untagged Clone

CAT#: SC118869

Reviews ()
Write a review

GAPDH (untagged)-Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH)



Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "GAPDH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GAPDH
Synonyms G3PD; GAPD; HEL-S-162eP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002046 edited
ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGG
GCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTC
AACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTC
AAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGA
GATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGC
GTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATC
ATCTCTGCCCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTAT
GACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTG
GCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCC
ATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGC
GGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTC
ATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTG
TCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAG
GTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAG
GTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTCGACGCTGGGGCTGGC
ATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTAC
AGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAA
>OriGene 5' read for NM_002046 unedited
ACGAGGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTGAN
ACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCA
CCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTG
ACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCA
CCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGG
AGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCA
CTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGG
TCATCATCTCTGCCCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTGAACCATGAGA
AGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAACAC
CCCTGGCCAAGGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTC
CATGCCATCACTGCCACCCAAAANACTGTGGGATGGCCCCCTNCGGGAAACTGTGGGCGT
GATGGCCCGNGGGGCTCTNCANAACATTATNCCTGCCTNTACTGGGCGCTGCCAAGGCTG
GGGGGCAAGGTCATTCCTTGAACTGAACGGGAANCTCACTGGCATGGGCCTTTCGTGTCC
CCCTGGCAACGTGTTAGGGGGGGGACCTGACCTGCCGTTAAAAAAANCTGCCAAATTGAT
GACCTCAAAAAGGGG
>OriGene 3' read for NM_002046 unedited
TTGGTATGGCAACTTCCAGGNCCAGGTANAGCACTGGGGNAGGGTCACAGGNATGCCACC
CGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTT
TTTTTTTTTGGTTGAGCACAGGGTACTTTATTGATGGTACATGACAAGGTGCGGCTCCCT
AGGCCCCTCCCCTCTTCAAGGGGTCTACATGGAAACTGTGAGGAGGGGAGATTCAGTGTG
GTGGGGGACTGAGTGTGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTTGTG
CTCTTGCTGGGGCTGGTGGTCCAGGGGTCTTACTCCTTGGAGGCCATGTGGGCCATGAGG
TCCACCACCCTGTTGCTGTAGCCAAATTCGTTGTCATACCAGGAAATGAGCTTGACAAAG
TGGTCGTTGAGGGCAATGCCAGCCCCAGCGTCNAAGGTGGAGGAGTGGGTGTCGCTGTTG
AAGTCAGAGGAGACCACCTGGTGCTCAGTGTANCCCAGGATGCCCTTGAGGGGGCCCTCC
GACGCCTGCTTCACCACCTTCTTGATGTCATCATATTTGGCAGGTTTTTCTAGACGGCAG
GTCAGGTCCACCACTGACACGTTGGCAGTGGGGACACGGAAGGCCATGCCAGTGAGCTTC
CCGTTCAGCTCAGGGATGACCTTGCCCACAGCCTTGGCAGCGCCAGTAAAGGCAGGGATG
ATGTTCTGGAGACCCCGCNGNCATCACGCACAGTTTCCCGGAGGGGGCATCCACAGTCTT
CTGGGTGCANNGATGGCATGGACCTGTGTCATGATTCCTTCACGATACCCAAAGTGCATG
GATGACCTGGNCAGGGTGCTAA
Restriction Sites NotI-NotI     
ACCN NM_002046
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002046.2, NP_002037.2
RefSeq Size 1283 bp
RefSeq ORF 1008 bp
Locus ID 2597
UniProt ID P04406
Cytogenetics 12p13.31
Domains gpdh
Protein Families ES Cell Differentiation/IPS
Protein Pathways Alzheimer's disease, Glycolysis / Gluconeogenesis, Metabolic pathways
Gene Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.