MIF (NM_002415) Human Untagged Clone

CAT#: SC118641

MIF (untagged)-Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MIF (NM_002415) Human Untagged Clone
Symbol MIF
Synonyms GIF; GLIF; MMIF
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118641 sequence for NM_002415 edited (data generated by NextGen Sequencing)
ATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTC
TCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTG
CACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGC
AGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTG
TGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTAC
GACATGAACGCGGCCAATGTGGGCTGGAACAACTCCACCTTCGCCTAA

Clone variation with respect to NM_002415.1
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002415 unedited
GTCAGATTTTGTAATACGACTTCACTATAGGGCGGCCGCGAATTCGCACGAGGGCGGCGC
GTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCG
TAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGC
AGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACC
AGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCG
GCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCG
AGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCA
ATGTGGGCTGGAACAACTCCACCTTCGCCTAAGAGCCGCAGGGACCCACGCTGTCTGCGC
TGGCTCCACCCGGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACCCCAACCTTCTG
GTGGGGAGAAATAAACGGTTTAGAGACTAAAAAAAAAAAAAAAAAACTCGACTCTAGATT
GCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCC
CCAGTGCCTCTCCTGGCCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCCTTGTCCTAA
TAAAATTAAGCTGCATCATTTTGCCTGACCAGGTGTCCCTTCATAATATTATGGGTGGCA
GGGGGTTGCTATGGACCAAGGGGCAAGTTGGGAAGAACACCTGTAGGCCCGCCGGGTCTA
TTGGGACCCAACCGGGAGGCCAGGGACCAATCTGGCTCACTGGAATCCCGCCTCCTGAGT
CAAGCGAATCTCCTGCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002415 unedited
ACTTCCAGGGCCAGGAAGCACTGGGGAGGGTCACAGGGATGCCACCCGGGATCTGTCAGA
AACAGCTATGACCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTAGTCTCT
AAACCGTTTATTTCTCCCCACCAGAAGGTTGGGGTGGGCGGGCCTAGAACACAGCGTGCG
GCGGGTTCCCGGGTGGAGCCAGCGCAGACAGCGTGGGTCCCTGCGGCTCTTAGGCGAAGG
TGGAGTTGTTCCAGCCCACATTGGCCGCGTTCATGTCGTAATAGTTGATGTAGACCCTGT
CCGGGCTGATGCGCAGGCGCTCGGCCAGCAGGCCGCACAGCAGCTTGCTGTAAGAGCGGT
TCTGCGCGCCGCCGATCTTGCCGATGCTGTGCAGGCTGCAGAGCGCGCACGGCTCGNNNG
AGCCGCCGAAGGCCATGAGCTGGTCCGGGACCACGTGCACCGCGATGTACTGGGGGGGCT
TGCCGGTGGCCTGCGCCAGCTGCTGNGTGAGCTCGGAAGGAACCCGTCCGGCACGGAGGC
GCGGGGCACGTTGGTGTTTACGATGAACATCGGCATGATGGCAGAAGGACCAGGAGACCC
GCGCAGAGGCACAGACGCACGCGCCGNCCTCGTGCCGAATTCGCGGCCGCCCTATAGTGA
GTCGTATTCAAAATTCTGACGGTTCACTAAACGAGCTCTGCTTTATAGNACCTCCACCGT
ACACGCCTACCGCCCATNNNNCCAACGGGCCGGGTTATTACGACATTNTGGAAAGTNCCG
TTGATTTTTGTGCCAAACAAACTCTCATTGACGTCAATGGGGTGGGAGACTTGNAAATTC
CCGGAGTTCAACCGCTATTCCGCCCATTGGTGTTCTGCCAAAACGNCACACCATGGNATA
GCGATGACTAATCGTANNAGTACTGCCAGTAGNAAAGTCCCGAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002415
ORF Size 348 bp
Insert Size 560
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002415.1, NP_002406
RefSeq Size 561
Locus ID 4282
Cytogenetics 22q11.23
Domains MIF
Protein Families Druggable Genome
Protein Pathways Tyrosine metabolism, Phenylalanine metabolism
Gene Summary This gene encodes a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations