YY1 (NM_003403) Human Untagged Clone

CAT#: SC118004

YY1 (untagged)-Human YY1 transcription factor (YY1)

USD 196.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name YY1 (NM_003403) Human Untagged Clone
Symbol YY1
Synonyms DELTA; INO80S; NF-E1; UCRBP; YIN-YANG-1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003403 edited
GCCTCTGCCTTCCTTCCCCACGGCCGGCCGCCTCCTCGCCCGCCCGCCCGCAGCCGAGGA
GCCGAGGCCGCCGCGGCCGTGGCGGCGGAGCCCTCAGCCATGGCCTCGGGCGACACCCTC
TACATCGCCACGGACGGCTCGGAGATGCCGGCCGAGATCGTGGAGCTGCACGAGATCGAG
GTGGAGACCATCCCGGTGGAGACCATCGAGACCACAGTGGTGGGCGAGGAGGAGGAGGAG
GACGACGACGACGAGGACGGCGGCGGTGGCGACCACGGCGGCGGGGGCGGCCACGGGCAC
GCCGGCCACCACCACCACCACCATCACCACCACCACCACCCGCCCATGATCGCTCTGCAG
CCGCTGGTCACCGACGACCCGACCCAGGTGCACCACCACCAGGAGGTGATCCTGGTGCAG
ACGCGCGAGGAGGTGGTGGGCGGCGACGACTCGGACGGGCTGCGCGCCGAGGACGGCTTC
GAGGATCAGATTCTCATCCCGGTGCCCGCGCCGGCCGGCGGCGACGACGACTACATTGAA
CAAACGCTGGTCACCGTGGCGGCGGCCGGCAAGAGCGGCGGCGGCGGCTCGTCGTCGTCG
GGAGGCGGCCGCGTCAAGAAGGGCGGCGGCAAGAAGAGCGGCAAGAAGAGTTACCTCAGC
GGCGGGGCCGGCGCGGCGGGCGGCGGCGGCGCCGACCCGGGCAACAAGAAGTGGGAGCAG
AAGCAGGTGCAGATCAAGACCCTGGAGGGCGAGTTCTCGGTCACCATGTGGTCCTCAGAT
GAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCA
CCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGC
ATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATT
AAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTC
AGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGT
GCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCAT
ACTGGAGAGAAGCCCTTTCAGTGCACGTTCGAAGGCTGTGGGAAACGCTTTTCACTGGAC
TTCAATTTGCGCACACATGTGCGAATCCATACCGGAGACAGGCCCTATGTGTGCCCCTTC
GATGGTTGTAATAAGAAGTTTGCTCAGTCAACTAACCTGAAATCTCACATCTTAACACAT
GCTAAGGCCAAAAACAACCAGTGAAAAGAAGAGAGAAGACCCTTCTCGACCACGGGAAGC
ATCTTCCAGAAGTGTGATTGGGAATAAATATGCCTCTCCTTTGTATATTATTTCTAGGAA
GAAT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003403 unedited
TCTATCCCCCGCCCGTTGCCGCAAATGGGCGTAGGCGTGTACGGTGGGAGGTCTATATAA
GCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGC
GAATTCGGCACGAGGCCTCTGCCTTCCTTCCCCACGGCCGGCCGCCTCCTCGCCCGCCCG
CCCGCAGCCGAGGAGCCGAGGCCGCCGCGGCCGTGGCGGCGGAGCCCTCAGCCATGGCCT
CGGGCGACACCCTCTACATCGCCACGGACGGCTCGGAGATGCCGGCCGAGATCGTGGAGC
TGCACGAGATCGAGGTGGAGACCATCCCGGTGGAGACCATCGAGACCACAGTGGTGGGCG
AGGAGGAGGAGGAGGACGACGACGACGAGGACGGCGGCGGTGGCGACCACGGCGGCGGGG
GCGGCCACGGGCACGCCGGCCACCACCACCACCACCATCACCACCACCACCACCCGCCCA
TGATCGCTCTGCAGCCGCTGGTCACCGACGACCCGACCCAGGTGCACCACCACCAGGAGG
TGATCCTGGTGCAGACGCGCGAGGAGGTGGTGGGCGGCGACGACTCGGACGGGCTGCGCG
CCGAGGACGGCTTCGAGGATCAGATTCTCATCCCGGTGCCCGCGCCGGCCGGCGGCGACG
ACGACTACATTGAACAAACGCTGGTCACCGTGGCGGCGGCCGGCAAGAGCGGCGGCGGCG
GCTCGTCGTCGTCGGGAGGCGGCCGCGTCAAGAAAGGCGGCNGCAAGAAGAGCGGCAAGA
AGAGTTACCTNCAGCGCGGGGCCCGCGCGGCGGGNCGGCGCNGCCCCCACCCGGGCACAA
GAAGTGGGAGCAGAAGCAGGTGCAGATCAAGACCCTGGAGGGGCGAGTCTCGGTCACCAT
GTGGTCCTCAGATGAAAAAAAGAATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003403 unedited
NTTACTTGNACCGCGCCGCATTCTANGATCGAGTTTTTTTTTTTTTTTTTTACTACTTTA
TCAAAACATGTCCCTTAGGTGTGTAGGATTCATTTTTAAAATTCTTCCTAGAAATAATAT
ACAAAGGAGAGGCATATTTATTCCCAATCACACTTCTGGAAGATGCTTCCCGTGGTCGAG
AAGGGTCTTCTCTCTTCTTTTCACTGGTTGTTTTTGGCCTTAGCATGTGTTAAGATGTGA
GATTTCAGGTTAGTTGACTGAGCAAACTTCTTATTACAACCATCGAAGGGGCACACATAG
GGCCTGTCTCCGGTATGGATTCGCACATGTGTGCGCAAATTGAAGTCCAGTGAAAAGCGT
TTCCCACAGCCTTCGAACGTGCACTGAAAGGGCTTCTCTCCAGTATGAACCAGTTGGTGT
CGTTTTAGTTTTGAACTCTCAACAAAAGCTTTGCCACATTCTGCACAGACGTGGACTCTG
GGACCGTGGGTGTGCAGATGTTTTCTCATGGCCGAGTTATCCCTGAACATCTTTGTGCAG
CCTTTATGAGGGCAAGCTATTGTTCTTGGAGCATCATCTTCTTTAATTTTTCTTGGCTTC
ATTCTAGCAAATTCTGCCAGTTGTTTGGGATCTGAGAGGTCAATGCCAGGTATTCCTCCA
GGAGGAAGTTTCTTTCCTGTCATATATTCTGAATAATCAGGAGGTGAGTTCTCTCCAATG
ATCTGGTCTTCAACCACTGTCTCATGGGCAATATCTTTTTTTTCATCTGAAGACCACATG
GTGACCGAGAACTCGCCCTCCGGGGCTTGATCTGCACCTGTTTCTGCTTCCACTCCTGTT
GCCCCGGTCGGGGCCCCCCCCCGCCGCCGGGCCGGTCCCCGCCGTGAATAACCTTTTTTG
CCCGTTTTTTGGCCCCCCCCTTTTGCCCGGGCGCCTCCCAAGACGAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003403
ORF Size 1245 bp
Insert Size 1640
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003403.3, NP_003394
RefSeq Size 2592
Locus ID 7528
Cytogenetics 14q32.2
Domains zf-C2H2
Protein Families Transcription Factors, Druggable Genome
Gene Summary YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations