DUSP1 (NM_004417) Human Untagged Clone

CAT#: SC117410

DUSP1 (untagged)-Human dual specificity phosphatase 1 (DUSP1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DUSP1 (NM_004417) Human Untagged Clone
Symbol DUSP1
Synonyms CL100; HVH1; MKP-1; MKP1; PTPN10
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004417 edited
GAATTCGGCACGGGCGCAGAGAGACCCGGGGGTCTAGCTTTTCCTCGAAAAGCGCCGCCC
TGCCCTTGGCCCCGAGAACAGACAAAGAGCACCGCAGGGCCGATCACGCTGGGGGCGCTG
AGGCCGGCCATGGTCATGGAAGTGGGCACCCTGGACGCTGGAGGCCTGCGGGCGCTGCTG
GGGGAGCGAGCGGCGCAATGCCTGCTGCTGGACTGCCGCTCCTTCTTCGCTTTCAACGCC
GGCCACATCGCCGGCTCTGTCAACGTGCGCTTCAGCACCATCGTGTGGCGCCGGGCCAAG
GGCGCCATGGGCCTGGAGCACATCGTGCCCAACGCCGAGCTCCGCGGCCGCCTGCTGGCC
GGCGCCTACCACGCCGTGGTGTTGCTGGACGAGCGCAGCGCCGCCCTGGACGGCGCCAAG
CGCGACGGCACCCTGGCCCTGGCGGCCGGCGCGCTCTGCCGCGAGGCGCGCGCCGCGCAA
GTCTTCTTCCTCAAAGGAGGATACGAAGCGTTTTCGGCTTCCTGCCCGGAGCTGTGCAGC
AAACAGTCGACCCCCATGGGGCTCAGCCTTCCCCTGAGTACTAGCGTCCCTGACAGCGCG
GAATCTGGGTGCAGTTCCTGCAGTACCCCACTCTACGATCAGGGTGGCCCGGTGGAAATC
CTGCCCTTTCTGTACCTGGGCAGTGCGTATCACGCTTCCCGCAAGGACATGCTGGATGCC
TTGGGCATAACTGCCTTGATCAACGTCTCAGCCAATTGTCCCAACCATTTTGAGGGTCAC
TACCAGTACAAGAGCATCCCTGTGGAGGACAACCACAAGGCAGACATCAGCTCCTGGTTC
AACGAGGCCATTGACTTCATAGACTCCATCAAGAATGCTGGAGGAAGGGTGTTTGTCCAC
TGCCAGGCAGGCATTTCCCGGTCAGCCACCATCTGCCTTGCTTACCTTATGAGGACTAAT
CGAGTCAAGCTGGACGAGGCCTTTGAGTTTGTGAAGCAGAGGCGAAGCATCATCTCTCCC
AACTTCAGCTTCATGGGCCAGCTGCTGCAGTTTGAGTCCCAGGTGCTGGCTCCGCACTGT
TCGGCAGAGGCTGGGAGCCCCGCCATGGCTGTGCTCGACCGAGGCACCTCCACCACCACC
GTGTTCAACTTCCCCGTCTCCATCCCTGTCCACTCCACGAACAGTGCGCTGAGCTACCTT
CAGAGCCCCATTACGACCTCTCCCAGCTGCTGAAAGGCCACGGGAGGTGAGGCTCTTCAC
ATCCCATTGGGACTCCATGCTCCTTGAGAGGAGAAATGCAATAACTCTGGGAGGGGCTCG
AGAGGGCTGGTCCTTATTTATTTAACTTCACCCGAGTTCCTCTGGGTTTCTAAGCAGTTA
TGGTGATGACTTAGCGTCAAGACATTTGCTGAACTCAGCACATTCGGGACCAATATATAG
TGGGTACATCAAGTCCATCTGACAAAATGGGGCAGAAGAGAAAGGACTCAGTGTGTGATC
CGGTTTCTTTTTGCTCGCCCCTGTTTTTTGTAGAATCTCTTCATGCTTGACATACCTACC
AGTATTATTCCCGACGACACATATACATATGAGAATATACCTTATTTATTTTTGTGTAGG
TGTCTGCCTTCACAAATGTCATTGTCTACTCCTAGAAGAACCAAATACCTCAATTTTTGT
TTTTGAGTACTGTACTATCCTGTAAATATATCTTAAGCAGGTTTGTTTTCAGCACTGATG
GAAAATACCAGTGTTGGGTTTTTTTTTAGTTGCCAACAGTTGTATGTTTGCTGATTATTT
ATGACCTGAAATAATATATTTCTTCTTCTAAGAAGACATTTTGTTACATAAGGATGACTT
TTTTATACAATGGAATAAATTATGGCATTTCTATTGAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004417 unedited
CAAAATTGTATACGACTCACTATAGGGCGGCCGCGAATTCGCACGGGCGCAGAGAGACCC
GGGGGTCTAGCTTTTCCTCGAAAGCGCCGCCCTGCCCTTGGCCCCGAGAACAGACAAAGA
GCACCGCAGGGCCGATCACGCTGGGGGCGCTGAGGCCGGCCATGGTCATGGAAGTGGGCA
CCCTGGACGCTGGAGGCCTGCGGGCGCTGCTGGGGGAGCGAGCGGCGCAATGCCTGCTGC
TGGACTGCCGCTCCTTCTTCGCTTTCAACGCCGGCCACATCGCCGGCTCTGTCAACGTGC
GCTTCAGCACCATCGTGTGGCGCCGGGCCAAGGGCGCCATGGGCCTGGAGCACATCGTGC
CCAACGCCGAGCTCCGCGGCCGCCTGCTGGCCGGCGCCTACCACGCCGTGGTGTTGCTGG
ACGAGCGCAGCGCCGCCCTGGACGGCGCCAAGCGCGACGGCACCCTGGCCCTGGCGGCCG
GCGCGCTCTGCCGCGAGGCGCGCGCCGCGCAAGTCTTCTTCCTCAAAGGAGGATACGAAG
CGTTTTCGGCTTCCTGCCCGGAGCTGTGCAGCAAACAGTCGACCCCCATGGGGCTCAGCC
TTCCCCTGAGTACTAGCGTCCCTGACAGCGCGGAATCTGGGTGCAGTTCCTGCAGTACCC
CACTCTACGATCAGGGTGGCCCGGTGGAAATCCTGCCCTTTCTGTACCTGGGCAGTGCGT
ATCACGCTTCCCGCAGGACATGCTGGATGCCTTGGCATAACTGCCTTGATCAACGTCTCA
GCCAATTGTCCCACCATTTTTGGGGTCACTACCAGTACAGAGCATCCCGGTGGGAGACAC
CCCCAAGCAGACTCAGCTCCTGGTTAACGAGCCATTGACTCATAACTCATCAGAGCTGAG
GAAAGGGGGGTGGTCCACTGCAGCAGCATTCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004417 unedited
AATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAATAAAAATGCCA
TAATTTATTCCATTGTATAAAAAAGTCATCCTTATGTAACAAAATGTCTTCTTAAAAAAA
AAAATATATTATTTCAGGTCATAAATAATCAGCAAACATACAACTGTTGGCAACTAAAAA
AAAACCCAACACTGGTATTTTCCATCAGGGCTGAAAACAAACCTGCTTAAAATATATTTA
CAGGATAGTACAGTCCTCAAAAACAAAAATTGAGGTATTTGGTTCTTCTAGGAGTAAACA
ATGACATTTGTGAAGGCAAACCCCTACACAAAAATAAATAAGGTATATTCTCATATGTAT
ATGGGCCGCCGGGAATAATACTGGTAGGTATGTCAAGCATGAAAAGATTCTACAAAAAAC
AGGGGCGAGCAAAAAGAAACCGGATCACACACTGAGTCCTTTCTCTTCTGCCCCATTTTG
TCAAATGGACTTGATGTACCCACTATATATTGGTCCCGAATGTGCTGAGTTCAGCAAATG
TCTTGACGCTAAGTCATCACCATAACTGCTTAGAAACCCAGAGGAACTCGGGTGAAGTTA
AATAAATAAGGACCAGCCCTCTAGAGCCCTTCCCAGATTATTGCATTTCTCCTCTCAAGA
GCATGGAGTCCCAATGGGATGTGAAGAGCCTCACCTCCCGTGGCCTTTCANCAGCTGGGA
AAAGGTCCTAATGGGGCTCTGAAGGTANCTCACCCCCCTTGTTCTGGAGTGAACAGGGAT
GGAACCGGGAANTTAACANCGGGGTGGTGGAGGTGCTTCGTCCAACCAGCCTGCGGGGCT
CCCACCTTTGCCAAAGTGCGAACCACACCTGGACTTAATGCNACACTGCCCATGAATTAA
TTGGGAAATTATCTCCTCTTGTTAAAAATAAAGGCTTGCCACTTGCTCCATATCCCTAAG
GAACAAGCAAATGGGCTACCGAAATCCTCTGAATG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004417
ORF Size 1104 bp
Insert Size 1880
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004417.2, NP_004408
RefSeq Size 2015
RefSeq ORF 1104
Locus ID 1843
Cytogenetics 5q35.1
Domains DSPc, RHOD, PTPc_motif
Protein Families Phosphatase, Druggable Genome
Protein Pathways MAPK signaling pathway
Gene Summary The expression of DUSP1 gene is induced in human skin fibroblasts by oxidative/heat stress and growth factors. It specifies a protein with structural features similar to members of the non-receptor-type protein-tyrosine phosphatase family, and which has significant amino-acid sequence similarity to a Tyr/Ser-protein phosphatase encoded by the late gene H1 of vaccinia virus. The bacterially expressed and purified DUSP1 protein has intrinsic phosphatase activity, and specifically inactivates mitogen-activated protein (MAP) kinase in vitro by the concomitant dephosphorylation of both its phosphothreonine and phosphotyrosine residues. Furthermore, it suppresses the activation of MAP kinase by oncogenic ras in extracts of Xenopus oocytes. Thus, DUSP1 may play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations