OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PIN1 (NM_006221) Human Untagged Clone

Be the first to review this product
SKU
SC116229
PIN1 (untagged)-Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA812247 PIN1 mouse monoclonal antibody,clone OTI4H1 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PIN1 or NM_006221"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PIN1
Synonyms DOD; UBL5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_006221 edited
ATGGCGGACGAGGAGAAGCTGCCGCCCGGCTGGGAGAAGCGCATGAGCCGCAGCTCAGGC
CGAGTGTACTACTTCAACCACATCACTAACGCCAGCCAGTGGGAGCGGCCCAGCGGCAAC
AGCAGCAGTGGTGGCAAAAACGGGCAGGGGGAGCCTGCCAGGGTCCGCTGCTCGCACCTG
CTGGTGAAGCACAGCCAGTCACGGCGGCCCTCGTCCTGGCGGCAGGAGAAGATCACCCGG
ACCAAGGAGGAGGCCCTGGAGCTGATCAACGGCTACATCCAGAAGATCAAGTCGGGAGAG
GAGGACTTTGAGTCTCTGGCCTCACAGTTCAGCGACTGCAGCTCAGCCAAGGCCAGGGGA
GACCTGGGTGCCTTCAGCAGAGGTCAGATGCAGAAGCCATTTGAAGACGCCTCGTTTGCG
CTGCGGACGGGGGAGATGAGCGGGCCCGTGTTCACGGATTCCGGCATCCACATCATCCTC
CGCACTGAGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006221 unedited
ATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCAGGAGGGAAGAT
GGCGGACGAGGAGAAGCTGCCGCCCGGCTGGGAGAAGCGCATGAGCCGCAGCTCAGGCCG
AGTGTACTACTTCAACCACATCACTAACGCCAGCCAGTGGGAGCGGCCCAGCGGCAACAG
CAGCAGTGGTGGCAAAAACGGGCAGGGGGAGCCTGCCAGGGTCCGCTGCTCGCACCTGCT
GGTGAAGCACAGCCAGTCACGGCGGCCCTCGTCCTGGCGGCAGGAGAAGATCACCCGGAC
CAAGGAGGAGGCCCTGGAGCTGATCAACGGCTACATCCAGAAGATCAAGTCGGGAGAGGA
GGACTTTGAGTCTCTGGCCTCACAGTTCAGCGACTGCAGCTCAGCCAAGGCCAGGGGAGA
CCTGGGTGCCTTCAGCAGAGGTCAGATGCAGAAGCCATTTGAAGACGCCTCGTTTGCGCT
GCGGACGGGGGAGATGAGCGGGCCCGTGTTCACGGATTCCGGCATCCACATCATCCTCCG
CACTGAGTGAGGGGTGGGGAGCCCAGGCCTGGCCTCGGGGCAGGGCAGGGCGGCTAGGCC
GGCCAGCTCCCCCTTGCCCGCCAGCCAGTGGCCGAACCCCCCACTCCCTGCCACCGTCAC
ACAGTATTTTATTGTTCCCACATGGCTGGNNAAGGGGCCCTTCAGAATTGGGGCCCTTTG
GGGTCCCCACTTCCTGTNNCATCCCAGTTGGGGGCTGCGACCGCCAGATTCTCCCTTAAG
GAATTGACTTAGCAGGGGGNGGGGGAGGCTCCCAGACANGCATGTGTGGNNNNNGGGNGN
TTTCNCAAAAAAAAGGGCTGGTAAAAAAAACGCCCCGGGTCCCCCAGGGGCT
Restriction Sites NotI-NotI |
ACCN NM_006221
Insert Size 1250 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006221.2, NP_006212.1
RefSeq Size 997 bp
RefSeq ORF 492 bp
Locus ID 5300
UniProt ID Q13526
Cytogenetics 19p13.2
Domains Rotamase, WW
Protein Families Druggable Genome
Protein Pathways RIG-I-like receptor signaling pathway
Summary Peptidyl-prolyl cis/trans isomerases (PPIases) catalyze the cis/trans isomerization of peptidyl-prolyl peptide bonds. This gene encodes one of the PPIases, which specifically binds to phosphorylated ser/thr-pro motifs to catalytically regulate the post-phosphorylation conformation of its substrates. The conformational regulation catalyzed by this PPIase has a profound impact on key proteins involved in the regulation of cell growth, genotoxic and other stress responses, the immune response, induction and maintenance of pluripotency, germ cell development, neuronal differentiation, and survival. This enzyme also plays a key role in the pathogenesis of Alzheimer's disease and many cancers. Multiple alternatively spliced transcript variants have been found for this gene.provided by RefSeq, Jun 2011
Transcript Variant: This variant (1) represents the predominant transcript and encodes the functional protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006221" in other vectors (6)
SKU Description Size Price
RC202543 PIN1 (Myc-DDK-tagged)-Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1) 10 ug
$150.00
RC202543L1 Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), Myc-DDK-tagged 10 ug
$450.00
RC202543L2 Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), mGFP tagged 10 ug
$450.00
RC202543L3 Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), Myc-DDK-tagged 10 ug
$450.00
RC202543L4 Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), mGFP tagged 10 ug
$450.00
RG202543 PIN1 (tGFP-tagged) - Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1) 10 ug
$489.00

file-alt Citations

Regulation of the miRNA-200b by transcriptional regulators PEA3 and ELK-1 affects expression of Pin1 to control anoikis
Zhang, Zhang, Gao et al
J. Biol. Chem. (2013)
AI Summary: OriGene's PCMV plasmids were used to express Pin1, PEA3, and ELK-1 in this study, enabling the authors to investigate how these transcriptional regulators and Pin1 impact miRNA-200b expression and anoikis in cancer cells.
Snippet: The plasmid for expression of miRNA-200b was pGCsilencer (GeneChem). The plasmid for expression of Pin1, PEA3, and ELK-1 was PCMV (Origene, NY, USA). The plasmid for expression of SUMO1 with the FLAG tag was kindly provided by Professor Jinke Cheng
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products