PIN1 (NM_006221) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PIN1 |
Synonyms | DOD; UBL5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_006221 edited
ATGGCGGACGAGGAGAAGCTGCCGCCCGGCTGGGAGAAGCGCATGAGCCGCAGCTCAGGC CGAGTGTACTACTTCAACCACATCACTAACGCCAGCCAGTGGGAGCGGCCCAGCGGCAAC AGCAGCAGTGGTGGCAAAAACGGGCAGGGGGAGCCTGCCAGGGTCCGCTGCTCGCACCTG CTGGTGAAGCACAGCCAGTCACGGCGGCCCTCGTCCTGGCGGCAGGAGAAGATCACCCGG ACCAAGGAGGAGGCCCTGGAGCTGATCAACGGCTACATCCAGAAGATCAAGTCGGGAGAG GAGGACTTTGAGTCTCTGGCCTCACAGTTCAGCGACTGCAGCTCAGCCAAGGCCAGGGGA GACCTGGGTGCCTTCAGCAGAGGTCAGATGCAGAAGCCATTTGAAGACGCCTCGTTTGCG CTGCGGACGGGGGAGATGAGCGGGCCCGTGTTCACGGATTCCGGCATCCACATCATCCTC CGCACTGAGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006221 unedited
ATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCAGGAGGGAAGAT GGCGGACGAGGAGAAGCTGCCGCCCGGCTGGGAGAAGCGCATGAGCCGCAGCTCAGGCCG AGTGTACTACTTCAACCACATCACTAACGCCAGCCAGTGGGAGCGGCCCAGCGGCAACAG CAGCAGTGGTGGCAAAAACGGGCAGGGGGAGCCTGCCAGGGTCCGCTGCTCGCACCTGCT GGTGAAGCACAGCCAGTCACGGCGGCCCTCGTCCTGGCGGCAGGAGAAGATCACCCGGAC CAAGGAGGAGGCCCTGGAGCTGATCAACGGCTACATCCAGAAGATCAAGTCGGGAGAGGA GGACTTTGAGTCTCTGGCCTCACAGTTCAGCGACTGCAGCTCAGCCAAGGCCAGGGGAGA CCTGGGTGCCTTCAGCAGAGGTCAGATGCAGAAGCCATTTGAAGACGCCTCGTTTGCGCT GCGGACGGGGGAGATGAGCGGGCCCGTGTTCACGGATTCCGGCATCCACATCATCCTCCG CACTGAGTGAGGGGTGGGGAGCCCAGGCCTGGCCTCGGGGCAGGGCAGGGCGGCTAGGCC GGCCAGCTCCCCCTTGCCCGCCAGCCAGTGGCCGAACCCCCCACTCCCTGCCACCGTCAC ACAGTATTTTATTGTTCCCACATGGCTGGNNAAGGGGCCCTTCAGAATTGGGGCCCTTTG GGGTCCCCACTTCCTGTNNCATCCCAGTTGGGGGCTGCGACCGCCAGATTCTCCCTTAAG GAATTGACTTAGCAGGGGGNGGGGGAGGCTCCCAGACANGCATGTGTGGNNNNNGGGNGN TTTCNCAAAAAAAAGGGCTGGTAAAAAAAACGCCCCGGGTCCCCCAGGGGCT |
Restriction Sites | NotI-NotI |
ACCN | NM_006221 |
Insert Size | 1250 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_006221.2, NP_006212.1 |
RefSeq Size | 997 bp |
RefSeq ORF | 492 bp |
Locus ID | 5300 |
UniProt ID | Q13526 |
Cytogenetics | 19p13.2 |
Domains | Rotamase, WW |
Protein Families | Druggable Genome |
Protein Pathways | RIG-I-like receptor signaling pathway |
Summary | Peptidyl-prolyl cis/trans isomerases (PPIases) catalyze the cis/trans isomerization of peptidyl-prolyl peptide bonds. This gene encodes one of the PPIases, which specifically binds to phosphorylated ser/thr-pro motifs to catalytically regulate the post-phosphorylation conformation of its substrates. The conformational regulation catalyzed by this PPIase has a profound impact on key proteins involved in the regulation of cell growth, genotoxic and other stress responses, the immune response, induction and maintenance of pluripotency, germ cell development, neuronal differentiation, and survival. This enzyme also plays a key role in the pathogenesis of Alzheimer's disease and many cancers. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011] Transcript Variant: This variant (1) represents the predominant transcript and encodes the functional protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202543 | PIN1 (Myc-DDK-tagged)-Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1) | 10 ug |
$150.00
|
|
RC202543L1 | Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC202543L2 | Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), mGFP tagged | 10 ug |
$450.00
|
|
RC202543L3 | Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC202543L4 | Lenti ORF clone of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), mGFP tagged | 10 ug |
$450.00
|
|
RG202543 | PIN1 (tGFP-tagged) - Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.