NC2 alpha (DRAP1) (NM_006442) Human Untagged Clone

SKU
SC116124
DRAP1 (untagged)-Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NC2 alpha
Synonyms NC2-alpha
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006442, the custom clone sequence may differ by one or more nucleotides


ATGCCGAGCAAGAAGAAGAAGTACAACGCGCGGTTCCCGCCGGCGCGGATCAAGAAGATCATGCAGACGG
ACGAAGAGATTGGGAAGGTGGCGGCGGCGGTGCCTGTCATCATCTCCCGGGCGCTCGAGCTCTTCCTAGA
GTCGCTGTTGAAGAAGGCCTGCCAGGTGACCCAGTCGCGGAACGCGAAGACCATGACCACATCCCACCTG
AAGCAGTGCATCGAGCTGGAGCAGCAGTTTGACTTCTTGAAGGACCTGGTGGCATCTGTTCCCGACATGC
AGGGGGACGGGGAAGACAACCACATGGATGGGGACAAGGGCGCCCGCAGGGGCCGGAAGCCAGGCAGCGG
CGGCCGGAAGAACGGTGGGATGGGAACGAAAAGCAAGGACAAGAAGCTGTCCGGGACAGACTCGGAGCAG
GAGGATGAATCTGAGGACACAGATACTGATGGGGAAGAGGAGACATCACAACCCCCACCCCAGGCCAGCC
ACCCCTCTGCCCACTTTCAGAGCCCCCCGACACCCTTCCTGCCCTTCGCCTCTACTCTGCCTTTGCCCCC
AGCGCCCCCGGGCCCCTCAGCACCTGATGAAGAGGACGAAGAAGATTACGACTCCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_006442 unedited
CACGAGGGGAGCCGGGAGGCTGCGGGCGGCGGCGCTGGACCCGACGCGGCGAGAGAGGCC
CCGAGATGCCGAGCAAGAAGAAGAAGTACAACGCGCGGTTCCCGCCGGCGCGGATCAAGA
AGATCATGCAGACGGACGAAGAGATTGGGAAGGTGGCGGCGGCGGTGCCTGTCATCATCT
CCCGGGCGCTCGAGCTCTTCCTAGAGTCGCTGTTGAAGAAGGCCTGCCAGGTGACCCAGT
CGCGGAACGCGAAGACCATGACCACATCCCACCTGAAGCAGTGCATCGAGCTGGAGCAGC
AGTTTGACTTCTTGAAGGACCTGGTGGCATCTGTTCCCGACATGCAGGGGGACGGGGAAG
ACAACCACATGGATGGGGACAAGGGCGCCCGCAGGGGCCGGAAGCCAGGCAGCGGCGGCC
GGAAGAACGGTGGGATGGGAACGAAAAGCAAGGACAAGAAGCTGTCCGGGACAGACTCGG
AGCAGGAGGATGAATCTGAGGACACAGATACTGATGGGGAAGAGGAACATNNACAAACCC
CCACCCCAGGCCAGCCACCCCTCTGCCCACTTTCAGAGCCCCCCGACACCCTTCCTGCCC
TTCGCCTCTACTCTGCCTTTGCCCCCAGCGCCCCCGGGCCCCTCAGCACCTGATGAAGAG
GACGAAGAAGATTACGACTCCTAGCGCCTTCTGCCCCCCAGACCATAGCCCCTTTTAGTT
GGTT
Restriction Sites NotI-NotI
ACCN NM_006442
Insert Size 890 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006442.2, NP_006433.2
RefSeq Size 988 bp
RefSeq ORF 618 bp
Locus ID 10589
UniProt ID Q14919
Cytogenetics 11q13.1
Protein Families Transcription Factors
Summary Transcriptional repression is a general mechanism for regulating transcriptional initiation in organisms ranging from yeast to humans. Accurate initiation of transcription from eukaryotic protein-encoding genes requires the assembly of a large multiprotein complex consisting of RNA polymerase II and general transcription factors such as TFIIA, TFIIB, and TFIID. DR1 is a repressor that interacts with the TATA-binding protein (TBP) of TFIID and prevents the formation of an active transcription complex by precluding the entry of TFIIA and/or TFIIB into the preinitiation complex. The protein encoded by this gene is a corepressor of transcription that interacts with DR1 to enhance DR1-mediated repression. The interaction between this corepressor and DR1 is required for corepressor function and appears to stabilize the TBP-DR1-DNA complex. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:NC2 alpha (DRAP1) (NM_006442) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204031 DRAP1 (Myc-DDK-tagged)-Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1) 10 ug
$300.00
RC204031L1 Lenti ORF clone of Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1), Myc-DDK-tagged 10 ug
$600.00
RC204031L2 Lenti ORF clone of Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1), mGFP tagged 10 ug
$600.00
RC204031L3 Lenti ORF clone of Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1), Myc-DDK-tagged 10 ug
$600.00
RC204031L4 Lenti ORF clone of Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1), mGFP tagged 10 ug
$600.00
RG204031 DRAP1 (tGFP-tagged) - Human DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.