Poliovirus Receptor (PVR) (NM_006505) Human Untagged Clone

SKU
SC116044
PVR (untagged)-Human poliovirus receptor (PVR), transcript variant 1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Poliovirus Receptor
Synonyms CD155; HVED; Necl-5; NECL5; PVS; TAGE4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC116044 representing NM_006505.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCGAGCCATGGCCGCCGCGTGGCCGCTGCTGCTGGTGGCGCTACTGGTGCTGTCCTGGCCACCC
CCAGGAACCGGGGACGTCGTCGTGCAGGCGCCCACCCAGGTGCCCGGCTTCTTGGGCGACTCCGTGACG
CTGCCCTGCTACCTACAGGTGCCCAACATGGAGGTGACGCATGTGTCACAGCTGACTTGGGCGCGGCAT
GGTGAATCTGGCAGCATGGCCGTCTTCCACCAAACGCAGGGCCCCAGCTATTCGGAGTCCAAACGGCTG
GAATTCGTGGCAGCCAGACTGGGCGCGGAGCTGCGGAATGCCTCGCTGAGGATGTTCGGGTTGCGCGTA
GAGGATGAAGGCAACTACACCTGCCTGTTCGTCACGTTCCCGCAGGGCAGCAGGAGCGTGGATATCTGG
CTCCGAGTGCTTGCCAAGCCCCAGAACACAGCTGAGGTTCAGAAGGTCCAGCTCACTGGAGAGCCAGTG
CCCATGGCCCGCTGCGTCTCCACAGGGGGTCGCCCGCCAGCCCAAATCACCTGGCACTCAGACCTGGGC
GGGATGCCCAATACGAGCCAGGTGCCAGGGTTCCTGTCTGGCACAGTCACTGTCACCAGCCTCTGGATA
TTGGTGCCCTCAAGCCAGGTGGACGGCAAGAATGTGACCTGCAAGGTGGAGCACGAGAGCTTTGAGAAG
CCTCAGCTGCTGACTGTGAACCTCACCGTGTACTACCCCCCAGAGGTATCCATCTCTGGCTATGATAAC
AACTGGTACCTTGGCCAGAATGAGGCCACCCTGACCTGCGATGCTCGCAGCAACCCAGAGCCCACAGGC
TATAATTGGAGCACGACCATGGGTCCCCTGCCACCCTTTGCTGTGGCCCAGGGCGCCCAGCTCCTGATC
CGTCCTGTGGACAAACCAATCAACACAACTTTAATCTGCAACGTCACCAATGCCCTAGGAGCTCGCCAG
GCAGAACTGACCGTCCAGGTCAAAGAGGGACCTCCCAGTGAGCACTCAGGCATGTCCCGTAACGCCATC
ATCTTCCTGGTTCTGGGAATCCTGGTTTTTCTGATCCTGCTGGGGATCGGGATTTATTTCTATTGGTCC
AAATGTTCCCGTGAGGTCCTTTGGCACTGTCATCTGTGTCCCTCGAGTACAGAGCATGCCAGCGCCTCA
GCTAATGGGCATGTCTCCTATTCAGCTGTGAGCAGAGAGAACAGCTCTTCCCAGGATCCACAGACAGAG
GGCACAAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_006505
Insert Size 1254 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006505.4
RefSeq Size 5903 bp
RefSeq ORF 1254 bp
Locus ID 5817
UniProt ID P15151
Cytogenetics 19q13.31
Domains ig, IG, IGv
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 45.3 kDa
Summary The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (alpha), also known as H20A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Poliovirus Receptor (PVR) (NM_006505) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202254 PVR (Myc-DDK-tagged)-Human poliovirus receptor (PVR), transcript variant 1 10 ug
$457.00
RC202254L1 Lenti ORF clone of Human poliovirus receptor (PVR), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC202254L2 Lenti ORF clone of Human poliovirus receptor (PVR), transcript variant 1, mGFP tagged 10 ug
$757.00
RC202254L3 Lenti ORF clone of Human poliovirus receptor (PVR), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC202254L4 Lenti ORF clone of Human poliovirus receptor (PVR), transcript variant 1, mGFP tagged 10 ug
$757.00
RG202254 PVR (tGFP-tagged) - Human poliovirus receptor (PVR), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.