ARPP19 (NM_006628) Human Untagged Clone

CAT#: SC115993

ARPP19 (untagged)-Human cAMP-regulated phosphoprotein, 19kDa (ARPP19)


  "NM_006628" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ARPP19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARPP19
Synonyms ARPP-16; ARPP-19; ARPP16; ENSAL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC115993 sequence for NM_006628 edited (data generated by NextGen Sequencing)
ATGTCTGCGGAAGTCCCCGAGGCAGCCTCCGCGGAGGAGCAGAAGGAAATGGAAGATAAA
GTGACTAGTCCAGAGAAAGCAGAAGAAGCAAAATTAAAAGCAAGATATCCTCATCTGGGA
CAAAAGCCTGGAGGTTCAGATTTCTTAAGGAAACGGTTGCAGAAAGGGCAAAAATATTTT
GATTCTGGGGATTACAACATGGCTAAAGCAAAAATGAAGAACAAGCAACTTCCTACTGCA
GCTCCGGATAAGACGGAGGTCACTGGTGACCACATTCCCACTCCGCAAGACCTTCCTCAA
CGGAAGCCGTCCCTTGTTGCTAGCAAGCTGGCTGGCTGA

Clone variation with respect to NM_006628.4
>OriGene 5' read for NM_006628 unedited
GTATTTTGTAATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGCATTTTCGCG
GGCGGAGGCGGCCCGGCGGGCCCTGGGAGAGCTGGGACGGGCGGCGGCCGGGTGGCCTCG
GCCACCCGCTAATTGCATCTTTTCCCGGCGTCTCGTCTGCAGAGGGAGCACTATGTCTGC
GGAAGTCCCCGAGGCAGCCTCCGCGGAGGAGCAGAAGGAAATGGAAGATAAAGTGACTAG
TCCAGAGAAAGCAGAAGAAGCAAAATTAAAAGCAAGATATCCTCATCTGGGACAAAAGCC
TGGAGGTTCAGATTTCTTAAGGAAACGGTTGCAGAAAGGGCAAAAATATTTTGATTCTGG
GGATTACAACATGGCTAAAGCAAAAATGAAGAACAAGCAACTTCCTACTGCAGCTCCGGA
TAAGACGGAGGTCACTGGTGACCACATTCCCACTCCGCAAGACCTTCCTCAACGGAAGCC
GTCCCTTGTTGCTAGCAAGCTGGCTGGCTGATTAAGAGGCTGAACTGCATGAATCTGCTA
AATCTCATTATTTCTCCTTAATATGTTACTTATCTACTTTTTATTTCCTTTCATTCACTA
GTCATTTGAGACTGACAGCTTTGCAGGTAGCAGTAGTGTGTGCTGCTATTGTGGAATATA
CGTGTGTAGAGTTTTTGATTAGTTTAACAGTGCACTGGTGAAGAGGACATGTTAGAGCAA
CATAAGTAAACTACTTGAAATAGTTGTATATATTACCTAACTTCTAGTGTAGTACTGGTT
CTAACAAGTAACCAAGCAGTTTTAANAATTTAATGTTTTGGCTNTCATTACTTCATCTTA
ATTATAGCTTT
Restriction Sites NotI-NotI     
ACCN NM_006628
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006628.4, NP_006619.1
RefSeq Size 5162 bp
RefSeq ORF 339 bp
Locus ID 10776
UniProt ID P56211
Cytogenetics 15q21.2
Domains endosulfine
Protein Families Druggable Genome
Gene Summary The 19-kD cAMP-regulated phosphoprotein plays a role in regulating mitosis by inhibiting protein phosphatase-2A (PP2A; see MIM 176915) (summary by Gharbi-Ayachi et al., 2010 [PubMed 21164014]).[supplied by OMIM, Feb 2011]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an in-frame exon in the CDS. The encoded isoform (2) is shorter than isoform 1. Both variants 3 and 4 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.