AK6 (NM_016283) Human Untagged Clone

SKU
SC114379
TAF9 (untagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AK6
Synonyms AD-004; CGI-137; CINAP; CIP; hCINAP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_016283, the custom clone sequence may differ by one or more nucleotides


ATGTTGCTTCCGAACATCCTGCTCACCGGTACACCAGGGGTTGGAAAAACCACACTAGGCAAAGAACTTG
CGTCAAAATCAGGACTGAAATACATTAATGTGGGTGATTTAGCTCGAGAAGAGCAATTGTATGATGGCTA
TGATGAAGAGTATGACTGTCCCATTTTAGATGAAGACAGAGTAGTTGATGAGTTAGATAACCAAATGAGA
GAAGGTGGAGTTATTGTTGATTACCATGGTTGTGATTTCTTCCCTGAACGCTGGTTTCATATAGTTTTTG
TGCTGAGAACAGATACCAATGTATTGTACGAAAGACTTGAAACAAGGGGTTATAATGAGAAGAAACTAAC
AGACAATATTCAGTGTGAGATTTTTCAAGTTCTTTATGAAGAAGCCACAGCATCCTACAAGGAAGAAATC
GTGCATCAGCTGCCCAGTAATAAACCAGAAGAGCTAGAAAATAATGTAGATCAGATCTTGAAATGGATTG
AGCAGTGGATCAAAGATCATAACTCTTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_016283 unedited
AGGATTTTGTAATACGACTCACTATAGGGCGGCCCGCGATTCGGCACGAGGGCGGCGGGG
ACCATGTTGCTTCCGAACATCCTGCTCACCGGTACACCAGGNGGTTGGAAAAACCACACT
AGGCAAAGAACTTGCGTCAAAATCAGGACTGAAATACATTAATGTGGGTGATTTAGCTCG
AGAAGTCTGATCATCGGATATCATGGAGTCTGGCAAGACGGCTTCTCCCAAGAGCATGCC
GAAAGATGCACAGATGATGGCACAAATCCTGAAGGATATGGGGATTACAGAATATGAGCC
AAGAGTTATAAATCAGATGTTGGAGTTTGCCTTCCGATATGTGACCACAATTCTAGATGA
TGCAAAAATTTATTCAAGCCATGCTAAGAAAGCTACTGTTGATGCAGATGATGTGCGATT
GGCAATCCAGTGCCGCGCTGATCAGTCTTTTACCTCTCCTCCCCCAAGAGATTTTTTATT
AGATATTGCAAGGCAAAGAAATCAAACCCCTTTGCCATTGATCAAGCCATATTCAGGTCC
TAGGTTGCCACCTGATAGATACTGCTTAACAGCTCCAAACTATAGGCTGAAATCTTTACA
GAAAAAGGCATCAACTTCTGCGGGAAGAATAACAGTCCCGCGGTTAAGTGTTGGTTCAGT
TACTAGCAGACCAAGTACTCCCACACTAGGCACACCAACCCCACCAGACCATGTCTGTTT
CAACTAAAGTAGGGACTCCCATGTCCCTCACAGGTCANAGGTTTACAGTACAGATGCCTA
CTTCTCAGTCTCCAGCTGTAAAAGCTTCAATTCCCTGCACCTCAGCANGTCAGAATGTTC
TGATTAATCCATCATTAATCGGNTCCAANNACATTCTTATTACCACTATATGATGTCATC
ACANATACTGCCCATGATCATCNATGCATTGAAAGAAACGTNGAGAGATGATGATGACAT
GAC
Restriction Sites NotI-NotI
ACCN NM_016283
Insert Size 1170 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016283.4, NP_057367.1
RefSeq Size 962 bp
RefSeq ORF 519 bp
Locus ID 102157402
UniProt ID Q9Y3D8
Cytogenetics 5q13.2
Summary This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) encodes the longer isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:AK6 (NM_016283) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200412 TAF9 (Myc-DDK-tagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2 10 ug
$300.00
RC200412L1 Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC200412L2 Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2, mGFP tagged 10 ug
$600.00
RC200412L3 Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC200412L4 Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2, mGFP tagged 10 ug
$600.00
RG200412 TAF9 (tGFP-tagged) - Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.