LEF1 (NM_016269) Human Untagged Clone

CAT#: SC114370

LEF1 (untagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name LEF1 (NM_016269) Human Untagged Clone
Symbol LEF1
Synonyms LEF-1; TCF10; TCF1ALPHA; TCF7L3
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016269 edited
GAATTCGGCACCAGGCTGCACGAACCCTTCCAACTCTCCTTTCCTCCCCCACCCTTGAGT
TACCCCTCTGTCTTTCCTGCTGTTGCGCGGGTGCTCCCACAGCGGAGCGGAGATTACAGA
GCCGCCGGGATGCCCCAACTCTCCGGAGGAGGTGGCGGCGGCGGGGGGGACCCGGAACTC
TGCGCCACGGACGAGATGATCCCCTTCAAGGACGAGGGCGATCCTCAGAAGGAAAAGATC
TTCGCCGAGATCAGTCATCCCGAAGAGGAAGGCGATTTAGCTGACATCAAGTCTTCCTTG
GTGAACGAGTCTGAAATCATCCCGGCCAGCAACGGACACGAGGTGGCCAGACAAGCACAA
ACCTCTCAGGAGCCCTACCACGACAAGGCCAGAGAACACCCCGATGACGGAAAGCATCCA
GATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATG
CCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGA
ACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTC
ATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGAT
GTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTAT
CCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCT
GTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACT
TCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGC
ATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGT
GACCTAATGCACGTGAAGCCTCAGCATGAATAGAGAAAGGAGCAGGAGCCAAAAAGACCT
CACATTAAGAAGCCTCTGAATGCTTTTATGTTATACATGAAAGAAATGAGAGCGAATGTC
GTTGCTGAGTGTACTCTAAAAGAAAGTGCAGCTATCAACCAGATTCTTGGCAGAAGGTGG
CATGCCCTCTCCCGTGAAGAGCAGGCTAAATATTATGAATTAGCACGGAAAGAAAGACAG
CTACATATGCAGCTTTATCCAGGCTGGTCTGCAAGAGACAATTATGGTAAGAAAAAGAAG
AGGAAGAGAGAGAAACTACAGGAATCTGCATCAGGTACAGGTCCAAGAATGACAGCTGCC
TACATCTGAAACATGGTGGAAAACGAAGCTCATTCCCAATGTGCAAAGCCAAGGCAGCGA
CCCCAGGACCTCTTCTGGAGATGGAAGCTTGTTGAAAACCCAGACTGTCTCCACGGCCTG
CCCAGTCGACCCCAAAGGAACACTGACATCAATTTTACCCTGAGGTCACTGCTAGAGACG
CTGATCCATAAAGACAATCACTGCCAACCCCTCTTTCGTCTACTGCAAGAGCCAAGTTCC
AAAATAAAGCATAAAAAGGTTTTTTAAAAGGAAATGTAAAAGCACATGAGAATGCTAGCA
GGCTGTGGGGCAGCTGAGCAGCTTTTCTCCCCCCATATCTGCGTGCACTTCCCAGAGCAT
CTTGCATCCAAACCTGTAACCTTTCGGCAAGGACGGTAACTTGGCTGCATTTGCCTGTCA
TGCGCAACTGGAGCCAGCAACCAGCACATCCATCAGCACCCCAGTGGAGGAGTTCATGGA
AGAGTTCCCTCTTTGTTTCTGCTTCATTTTTCTTTCTTTTCTTTTCTCCTAAAGCTTTTA
TTTAACAGTGCAAAAGGATCGTTTTTTTTTGCTTTTTTAAACTTGAATTTTTTTAATTTA
CACTTTTTAGTTTTAATTTTCTTGTATATTTTGCTAGCTATGAGCTTTTAAATAAAATTG
AAAGTTCTGGAAAAGTTTGAAATAATGACATAAAAAGAAGCCTTCTTTTTCTGAGACAGC
TTGTCTGGTAAGTGGCTTCTCTGTGAATTGCCTGTAACACATAGTGGCTTCTCCGCCCTT
GTAAGGTGTTCAGTAGAGCTAAATAAATGTAATAGCCAAACCCACTCTGTTGGTAGCAAT
TGGCAGCCCTATTTCAGTTTATTTTTTCTTCTGTTTTCTTCTTTTCTTTTTTTAAACAGT
AAACCTTAACAGATGCGTTCAGCAGACTGGTTTGCAGTGAATTTTCATTTCTTTCCTTAT
CACCCCCTTGTTGTAAAAAGCCCAGCACTTGAATTGTTATTACTTTAAATGTTCTGTATT
TGTATCTGTTTTTATTAGCCAATTAGTGGGATTTTATGCCAGTTGTTAAAATGAGCATTG
ATGTACCCATTTTTTAAAAAAGCAAGGCACAGCCTTTGCCCAAAACTGTCATCCTAACGT
TTGTCATTCCAGTTTGAGTTAATGTGCTGAGCATTTTTTTAAAAGAAGCTTTGTAATAAA
ACATTTTTAAAAATTAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016269 unedited
NGTAACGTCAAATATTTGTATACGACTCACTNATAGGGCGGCCGCGAATTCGCACCAGGC
TGCACGAACCCTTCCAACTCTCCTTTCCTCCCCCACCCTTGAGTTACCCCTCTGTCTTTC
CTGCTGTTGCGCGGGTGCTCCCACAGCGGAGCGGAGATTACAGAGCCGCCGGGATGCCCC
AACTCTCCGGAGGAGGTGGCGGCGGCGGGGGGGACCCGGAACTCTGCGCCACGGACGAGA
TGATCCCCTTCAAGGACGAGGGCGATCCTCAGAAGGAAAAGATCTTCGCCGAGATCAGTC
ATCCCGAAGAGGAAGGCGATTTAGCTGACATCAAGTCTTCCTTGGTGAACGAGTCTGAAA
TCATCCCGGCCAGCAACGGACACGAGGTGGCCAGACAAGCACAAACCTCTCAGGAGCCCT
ACCACGACAAGGCCAGAGAACACCCCGATGACGGAAAGCATCCAGATGGAGGCCTCTACA
ACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACG
ACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGC
CCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACG
AGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAG
GCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTG
GTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGG
GGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTTCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_016269 unedited
TGTACCGCGGCACGCAATCTAGTGTCGAGTTTTTTTTTTTTTTTTTTAATTTTTAAAAAT
GTTTTATTACAAAGCTTCTTTTAAAAAATGCTCAGCACATTAACTCAAACTGGAATGACA
AACGTTAGGATGACAGTTTTGGGCAAAGGCTGTGCCTTGCTTTTTTAAAAAATGGGTACA
TCAATGCTCATTTTAACAACTGGCATAAAATCCCACTAATTGGCTAATAAAAACAGATAC
AAATACAGAACATTTAAAGTAATAACAATTCAAGTGCTGGGCTTTTTACAACAAGGGGGT
GATAAGGAAAGAAATGAAAATTCACTGCAAACCAGTCTGCTGAACGCATCTGTTAAGGTT
TACTGTTTAAAAAAAGAAAAGAAGAAAACAGAAGAAAAAATAAACTGAAATAGGGCTGCC
AATTGCTACCAACAGAGTGGGTTTGGCTATTACATTTATTTAGCTCTACTGAACACCTTA
CAAGGGCGGAGAAGCCACTATGTGTTACAGGCAATTCACAGAGAAGCCACTTACCAGACA
AGCTGTCTCAGAAAAAGAAAGCTTCTTTTTATGTCATTATTTCAAACTTTTCCAGAACTT
TCAATTTTATTTAAAAGCTCATAGCTAGCAAAATATACAAGATAATTAAAACTAAAAAGT
GTAAATTAAAAAAATTCAAGCTTAAAAAAGCAAAAAAAAACGATCCTTTTGCACTGCTAA
ATAAAAGCTTTACGAGAAAAGATAAGAAAGATAAATGAAGCCGAAACCAAGAAGGAACTC
TTCCATGAACTCCTNCACTGGAGTGCTGATGGATGTGCTAGGTGCTGGGCTCCATTGCGC
ATGACAGGCAATGCAGCCAAGTTACCGTCCTTGCCGAAGGTTACAAGTTTGGATGCANAA
TGCTCCTGGAAGTGCACCCATTATGGGGGGAGATAGCTGCTCANCTGCCCACAGCCTGCT
GCATTCTCATGGGCTTTAATTNNTCTTTAAAAAACCTTTTATGCTNAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_016269
ORF Size 1200 bp
Insert Size 2660
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_016269.2, NP_057353
RefSeq Size 3084
RefSeq ORF 1200
Locus ID 51176
Cytogenetics 4q25
Domains HMG
Protein Families ES Cell Differentiation/IPS, Adult stem cells, Transcription Factors, Druggable Genome
Protein Pathways Wnt signaling pathway, Adherens junction, Melanogenesis, Pathways in cancer, Colorectal cancer, Endometrial cancer, Prostate cancer, Thyroid cancer, Basal cell carcinoma, Acute myeloid leukemia, Arrhythmogenic right ventricular cardiomyopathy (ARVC)
Gene Summary This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations