HEPC (HAMP) (NM_021175) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HEPC |
Synonyms | HEPC; HFE2B; LEAP1; PLTR |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_021175 edited
ATGGCACTGAGCTCCCAGATCTGGGCCGCTTGCCTCCTGCTCCTCCTCCTCCTCGCCAGC CTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGACAACTTGCAGAGCTGCAACCCCAG GACAGAGCTGGAGCCAGGGCCAGCTGGATGCCCATGTTCCAGAGGCGAAGGAGGCGAGAC ACCCACTTCCCCATCTGCATTTTCTGCTGCGGCTGCTGTCATCGATCAAAGTGTGGGATG TGCTGCAAGACGTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_021175 unedited
NGGGTCAGATTTGTATACGACTCATATAGGCGGCNCGCGAATTCGCACCAAAAGACCCAG CAGTGGGACAGCCAGACAGACGGCACGATGGCACTGAGCTCCCAGATCTGGGCCGCTTGC CTCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACG GGACAACTTGCAGAGCTGCAACCCCAGGACAGAGCTGGAGCCAGGGCCAGCTGGATGCCC ATGTTCCAGAGGCGAAGGAGGCGAGACACCCACTTCCCCATCTGCATTTTCTGCTGCGGC TGCTGTCATCGATCAAAGTGTGGGATGTGCTGCAAGACGTAGAACCTACCTGCCCTGCCC CCGTCCCCTCCCTTCCTTATTTATTCCTGCTGCCCCAGAACATAGGTCTTGGAATAAAAT GGCTGGTTCTTTTGTTTTCCAAAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCGGCCG CGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGC CTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAA GTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGNGGTG GTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGNGTCTATTGGGAA CCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAA GCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGNCATGCATNGACCAGCTC AGCTAATTTTTGGTTTTTTGGTAGAGACGGGGNTTCACCATATTGGGCCAGCTGGTCTCC AACTCTAATCTCAGTGATCTACC |
Restriction Sites | NotI-NotI |
ACCN | NM_021175 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_021175.2, NP_066998.1 |
RefSeq Size | 430 bp |
RefSeq ORF | 255 bp |
Locus ID | 57817 |
UniProt ID | P81172 |
Cytogenetics | 19q13.12 |
Protein Families | Secreted Protein, Transmembrane |
Summary | The product encoded by this gene is involved in the maintenance of iron homeostasis, and it is necessary for the regulation of iron storage in macrophages, and for intestinal iron absorption. The preproprotein is post-translationally cleaved into mature peptides of 20, 22 and 25 amino acids, and these active peptides are rich in cysteines, which form intramolecular bonds that stabilize their beta-sheet structures. These peptides exhibit antimicrobial activity against bacteria and fungi. Mutations in this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis, a disease caused by severe iron overload that results in cardiomyopathy, cirrhosis, and endocrine failure. [provided by RefSeq, Oct 2014] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC204620 | HAMP (Myc-DDK-tagged)-Human hepcidin antimicrobial peptide (HAMP) | 10 ug |
$150.00
|
|
RC204620L1 | Lenti ORF clone of Human hepcidin antimicrobial peptide (HAMP), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC204620L2 | Lenti ORF clone of Human hepcidin antimicrobial peptide (HAMP), mGFP tagged | 10 ug |
$450.00
|
|
RC204620L3 | Lenti ORF clone of Human hepcidin antimicrobial peptide (HAMP), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC204620L4 | Lenti ORF clone of Human hepcidin antimicrobial peptide (HAMP), mGFP tagged | 10 ug |
$450.00
|
|
RG204620 | HAMP (tGFP-tagged) - Human hepcidin antimicrobial peptide (HAMP) | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.