FOXM1 (NM_021953) Human Untagged Clone

CAT#: SC112825

FOXM1 (untagged)-Human forkhead box M1 (FOXM1), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FOXM1 (NM_021953) Human Untagged Clone
Symbol FOXM1
Synonyms FKHL16; FOXM1B; HFH-11; HFH11; HNF-3; INS-1; MPHOSPH2; MPP-2; MPP2; PIG29; TGT3; TRIDENT
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC112825 sequence for NM_021953 edited (data generated by NextGen Sequencing)
ATGAAAACTAGCCCCCGTCGGCCACTGATTCTCAAAAGACGGAGGCTGCCCCTTCCTGTT
CAAAATGCCCCAAGTGAAACATCAGAGGAGGAACCTAAGAGATCCCCTGCCCAACAGGAG
TCTAATCAAGCAGAGGCCTCCAAGGAAGTGGCAGAGTCCAACTCTTGCAAGTTTCCAGCT
GGGATCAAGATTATTAACCACCCCACCATGCCCAACACGCAAGTAGTGGCCATCCCCAAC
AATGCTAATATTCACAGCATCATCACAGCACTGACTGCCAAGGGAAAAGAGAGTGGCAGT
AGTGGGCCCAACAAATTCATCCTCATCAGCTGTGGGGGAGCCCCAACTCAGCCTCCAGGA
CTCCGGCCTCAAACCCAAACCAGCTATGATGCCAAAAGGACAGAAGTGACCCTGGAGACC
TTGGGACCAAAACCTGCAGCTAGGGATGTGAATCTTCCTAGACCACCTGGAGCCCTTTGC
GAGCAGAAACGGGAGACCTGTGCAGATGGTGAGGCAGCAGGCTGCACTATCAACAATAGC
CTATCCAACATCCAGTGGCTTCGAAAGATGAGTTCTGATGGACTGGGCTCCCGCAGCATC
AAGCAAGAGATGGAGGAAAAGGAGAATTGTCACCTGGAGCAGCGACAGGTTAAGGTTGAG
GAGCCTTCGAGACCATCAGCGTCCTGGCAGAACTCTGTGTCTGAGCGGCCACCCTACTCT
TACATGGCCATGATACAATTCGCCATCAACAGCACTGAGAGGAAGCGCATGACTTTGAAA
GACATCTATACGTGGATTGAGGACCACTTTCCCTACTTTAAGCACATTGCCAAGCCAGGC
TGGAAGAACTCCATCCGCCACAACCTTTCCCTGCACGACATGTTTGTCCGGGAGACGTCT
GCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCCAGTGCCAACCGCTACTTGACATTG
GACCAGGTGTTTAAGCCACTGGACCCAGGGTCTCCACAATTGCCCGAGCACTTGGAATCA
CAGCAGAAACGACCGAATCCAGAGCTCCGCCGGAACATGACCATCAAAACCGAACTCCCC
CTGGGCGCACGGCGGAAGATGAAGCCACTGCTACCACGGGTCAGCTCATACCTGGTACCT
ATCCAGTTCCCGGTGAACCAGTCACTGGTGTTGCAGCCCTCGGTGAAGGTGCCATTGCCC
CTGGCGGCTTCCCTCATGAGCTCAGAGCTTGCCCGCCATAGCAAGCGAGTCCGCATTGCC
CCCAAGGTGCTGCTAGCTGAGGAGGGGATAGCTCCTCTTTCTTCTGCAGGACCAGGGAAA
GAGGAGAAACTCCTGTTTGGAGAAGGGTTTTCTCCTTTGCTTCCAGTTCAGACTATCAAG
GAGGAAGAAATCCAGCCTGGGGAGGAAATGCCACACTTAGCGAGACCCATCAAAGTGGAG
AGCCCTCCCTTGGAAGAGTGGCCCTCCCCGGCCCCATCTTTCAAAGAGGAATCATCTCAC
TCCTGGGAGGATTCGTCCCAATCTCCCACCCCAAGACCCAAGAAGTCCTACAGTGGGCTT
AGGTCCCCAACCCGGTGTGTCTCGGAAATGCTTGTGATTCAACACAGGGAGAGGAGGGAG
AGGAGCCGGTCTCGGAGGAAACAGCATCTACTGCCTCCCTGTGTGGATGAGCCGGAGCTG
CTCTTCTCAGAGGGGCCCAGTACTTCCCGCTGGGCCGCAGAGCTCCCGTTCCCAGCAGAC
TCCTCTGACCCTGCCTCCCAGCTCAGCTACTCCCAGGAAGTGGGAGGACCTTTTAAGACA
CCCATTAAGGAAACGCTGCCCATCTCCTCCACCCCGAGCAAATCTGTCCTCCCCAGAACC
CCTGAATCCTGGAGGCTCACGCCCCCAGCCAAAGTAGGGGGACTGGATTTCAGCCCAGTA
CAAACCTCCCAGGGTGCCTCTGACCCCTTGCCTGACCCCCTGGGGCTGATGGATCTCAGC
ACCACTCCCTTGCAAAGTGCTCCCCCCCTTGAATCACCGCAAAGGCTCCTCAGTTCAGAA
CCCTTAGACCTCATCTCCGTCCCCTTTGGCAACTCTTCTCCCTCAGATATAGACGTCCCC
AAGCCAGGCTCCCCGGAGCCACAGGTTTCTGGCCTTGCAGCCAATCGTTCTCTGACAGAA
GGCCTGGTCCTGGACACAATGAATGACAGCCTCAGCAAGATCCTGCTGGACATCAGCTTT
CCTGGCCTGGACGAGGACCCACTGGGCCCTGACAACATCAACTGGTCCCAGTTTATTCCT
GAGCTACAGTAG

Clone variation with respect to NM_021953.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_021953 unedited
GTGTACCATTTTGTAATACAACTCACTATAGGCGGCCGCGAAATTCGCACGAGGGGTCCA
CACTTGTGATTCTCAATGGAGAGTGAAAACGCAGATTCATAATGAAAACTAGCCCCCGTC
GGCCACTGATTCTCAAAAGACGGAGGCTGCCCCTTCCTGTTCAAAATGCCCCAAGTGAAA
CATCAGAGGAGGAACCTAAGAGATCCCCTGCCCAACAGGAGTCTAATCAAGCAGAGGCCT
CCAAGGAAGTGGCAGAGTCCAACTCTTGCAAGTTTCCAGCTGGGATCAAGATTATTAACC
ACCCCACCATGCCCAACACGCAAGTAGTGGCCATCCCCAACAATGCTAATATTCACAGCA
TCATCACAGCACTGACTGCCAAGGGAAAAGAGAGTGGCAGTACTGGGCCCAACAAATTCA
TCCTCATCACCTGTGGGGGAGCCCCAACTCAGCCTCCAGGACTCCGGCCTCAAACCCAAA
CCAGCTATGATGCCAAAAGGACAGAAGTGACCCTGGAGACCTTGGGACCAAAACCTGCAG
CTAGGGATGTGAATCTTCCTAGACCACCTGTAGCCCTTTGCGAGCAGAAACGGGAGACCT
GTGCAGATGGTGAGGCACCAGGCTGCACTATCAACAATAGCCTATTCCACATCCAGTGGC
CTTCGAAAGATGAGTCCTGATGGCCTGGGCCTCCCCAGCATCAAGCCAGAGATGGAGGGA
AAGGAAAATTTGTCACCTCGGGCACACCACAGGTTAAGGTTGAAGAGCCTTCCGAAACCT
CATCGTCCCGGAACAACCCTGTGTCTCGACGGACACCTCACTCTTACATGGGCATGAAAC
CAATCGCCATCAACCCCATTGATAAGAAGCCCATGCACTTTGAAAACATCTATACGTCGC
ATTGAGGACCCTCTTCCTTACTTAACCCCTTTGCCAGCCAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_021953 unedited
AATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGCATGTCCACCTTCGCTTTTATTGAGTA
GTTAGTGTTCTCAAGCTGGCTCACACCCATGCGGTCAGCTGGGGCCTAGGGTGGCTCTTT
GCAAAGCTGAGGGGCAAGCTAAGGAAGCCAGGCAGGTCAGGGGCCCTTTCGGCCTTCTCA
AGCCTCCACCTGAGTTCTCGTCAATGCCAGTCTCCCTGGTATGATTGGGGACATTATCAG
AGAAACATCTAATAGCGCACATCTGGGCACCCACACTCTGCTTCAGTTGCATCCATCCTC
CCACCCCAAATTCAACTCCTGACCCAATACAAAAGACTTTTTTAACCAGGATTTCTTCTT
GCAGGAAAGCTGACTTGGAAACACGGGGAGGTGGCAGGGAGGGGCAAAAAGGACTCTGGC
AAGCAGATCCACTTGTCTGGGTCCCTGCAGTGAAGAACCCAAGATCCAGGTACCTCAGCC
TGGAAGAAACCGTGCACTGCAGGTCTTCCCTTCTATCAAAACTAAAAGCAAGGAACAGAA
GTCAATTGAAACCCCAGGTCATCCTACCCACCTTCTGGCAGTCTCTGGATAATGATCTAA
GGAAATAAGCTTACATTTATAATTAGAGGATAATTTGGAGAATTTATACTATTTACACGG
ACCACNCCTGCAAGATCAGGNAAGGGTAGAGACTGCTGGGCAGAGAATGGAAACAGGCTG
GAGGGNTCCTAATCTCTTTTACCATTGGCTTAGTAGNTCCACCCCNCAGCTTCTGGCAGG
GACAGCAGATGAATCAGATACTCCTGGGGAACACAAAGTCCCANCAGTGGCTATGGTGTG
ACTGCTACTTTTGCATATCCAGGCACCAAGGAGCTATGAGGAGCANAANCAGTCCTGGCC
TGCTGCCCTCACTCAAAGGCTCGGGNTGACCTGAGCCTTGGATGCCCCGGATGTTGGCAG
CTTGNCCAAGGGCAAGCCAGGCCTTACTGACTCAGGATAACTGGACANNTGAGTGTCAGG
CCCAAGGGTCCTTCC
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_021953
ORF Size 2292 bp
Insert Size 3460
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021953.2, NP_068772
RefSeq Size 3527
RefSeq ORF 2292
Locus ID 2305
Cytogenetics 12p13.33
Domains FH
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations