HDAC3 (NM_003883) Human Untagged Clone

CAT#: SC112704

Reviews ()
Write a review

HDAC3 (untagged)-Human histone deacetylase 3 (HDAC3)



Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "HDAC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HDAC3
Synonyms HD3; KDAC3; RPD3; RPD3-2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC112704 sequence for NM_003883 edited (data generated by NextGen Sequencing)
ATGGCCAAGACCGTGGCCTATTTCTACGACCCCGACGTGGGCAACTTCCACTACGGAGCT
GGACACCCTATGAAGCCCCATCGCCTGGCATTGACCCATAGCCTGGTCCTGCATTACGGT
CTCTATAAGAAGATGATCGTCTTCAAGCCATACCAGGCCTCCCAGCATGACATGTGCCGC
TTCCACTCCGAGGACTACATTGACTTCCTGCAGAGAGTCAGCCCCACCAATATGCAAGGC
TTCACCAAGAGTCTTAATGCCTTCAACGTAGGCGATGACTGCCCAGTGTTTCCCGGGCTC
TTTGAGTTCTGCTCGCGTTACACAGGCGCATCTCTGCAAGGAGCAACCCAGCTGAACAAC
AAGATCTGTGATATTGCCATTAACTGGGCTGGTGGTCTGCACCATGCCAAGAAGTTTGAG
GCCTCTGGCTTCTGCTATGTCAACGACATTGTGATTGGCATCCTGGAGCTGCTCAAGTAC
CACCCTCGGGTGCTCTACATTGACATTGACATCCACCATGGTGACGGGGTTCAAGAAGCT
TTCTACCTCACTGACCGGGTCATGACGGTGTCCTTCCACAAATACGGAAATTACTTCTTC
CCTGGCACAGGTGACATGTATGAAGTCGGGGCAGAGAGTGGCCGCTACTACTGTCTGAAC
GTGCCCCTGCGGGATGGCATTGATGACCAGAGTTACAAGCACCTTTTCCAGCCGGTTATC
AACCAGGTAGTGGACTTCTACCAACCCACGTGCATTGTGCTCCAGTGTGGAGCTGACTCT
CTGGGCTGTGATCGATTGGGCTGCTTTAACCTCAGCATCCGAGGGCATGGGGAATGCGTT
GAATATGTCAAGAGCTTCAATATCCCTCTACTCGTGCTGGGTGGTGGTGGTTATACTGTC
CGAAATGTTGCCCGCTGCTGGACATATGAGACATCGCTGCTGGTAGAAGAGGCCATTAGT
GAGGAGCTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGACTTCACACTTCATCCA
GATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAG
ACAATCTTTGAAAACCTGAAGATGCTGAACCATGCACCTAGTGTCCAGATTCATGACGTG
CCTGCAGACCTCCTGACCTATGACAGGACTGATGAGGCTGATGCAGAGGAGAGGGGTCCT
GAGGAGAACTATAGCAGGCCAGAGGCACCCAATGAGTTCTATGATGGAGACCATGACAAT
GACAAGGAAAGCGATGTGGAGATTTAA

Clone variation with respect to NM_003883.3
165 a=>g
>OriGene 5' read for NM_003883 unedited
NNNCCTGTCANAAATTGTATACGACTCCTATAGGCGGCCCGCGAATTCGCACCAGGCCGC
GGGCGGCGGGCGGCGGAGGTGCGGGGCCTGCTCCCGCCGGCACCATGGCCAAGACCGTGG
CCTATTTCTACGACCCCGACGTGGGCAACTTCCACTACGGAGCTGGACACCCTATGAAGC
CCCATCGCCTGGCATTGACCCATAGCCTGGTCCTGCATTACGGTCTCTATAAGAAGATGA
TCGTCTTCAAGCCATACCAGGCCTCCCAGCATGACATGTGCCGCTTCCACTCCGAGGACT
ACATTGACTTCCTGCAGAGAGTCAGCCCCACCAATATGCAAGGCTTCACCAAGAGTCTTA
ATGCCTTCAACGTAGGCGATGACTGCCCAGTGTTTCCCGGGCTCTTTGAGTTCTGCTCGC
GTTACACAGGCGCATCTCTGCAAGGAGCAACCCAGCTGAACAACAAGATCTGTGATATTG
CCATTAACTGGGCTGGTGGTCTGCACCATGCCAAGAAGTTTGAGGCCTCTGGCTTCTGCT
ATGTCAACGACATTGTGATTGGCATCCTGGAGCTGCTCAAGTACCACCCTCGGGTGCTCT
ACATTGACATTGACATCCACCATGGTGACGGNGTTCAAGAAGCTTTCTACCTCACTGACC
GNGTCATGACGGTGTCCTTCCACAAATACGGAAATTACTTCTTCCCTGGCACAGGTGACA
TGTATGAAGTCGGNGCAGAGAGTGGCCGCTACTACTGTCTGAACGTGCCCCTGCGGNATG
GCATTGATGACCAGAGNTACAAGCACCTTTTCCAGCCGGNTATCAACCAGNTAGTGGACT
TCTACCAACCCACGTGCATTGTGCTTCAGTGTGGAGCTGACTCTCTGGCCTC
>OriGene 3' read for NM_003883 unedited
CCAAAAGTGAGTTTCAGACATTTTCATATCCTCCCCACACTTGAAAACATACTTCCCATC
ATCTGGGATTCAGGTGTTAGGGAGCCAGAGCCCCTTCCAAATCTCTCTCTCTTCATCTTC
CCTGGAAGCAAGGGGAGGAAGAAGTCAGAACCCAGAGGATGAGGTANNTANAGCAATCTC
AGTCCTTGTCTACCCGTTCATCCCTCAAAAATCTCTGGGTTCGAGGGAAGCAGGGAAGAA
ATAAGGGGCAAGGGGGGCTAGGGACTGGCCTCCAGGGCCCACTGCCAATAATGTCCCAGA
TAGCTATCCTTGTCTGTATCTCATCCCTAATAGGTACCATTGTCAGGCCTTGGGAGAGAG
AGGAAAAGCAGGTAGATGGTTCGAGAACCAAATGTGGTCTCCAGACTCTTTCCCAGAGTC
AGCAAAAGCCCTGGGGTGAACCCCAGGACTCTAGGAGCCACTCCTTTTCCCTCCAGCCCA
ACCAAGAGGTGAAAAGAAATTCCTTGGGACACAGCATCCCAAGCCACTCTTAAATCTCCA
CATCGCTTTCCTTGTCATTGTCATGGTCTCCATCATAGAACTCATTGGGTGCCTCTGGCC
TGCTATAGTTCTCCTCAGGACCCCTCTCCTCTGCATCAGCCTCATCAGTCCTGTCATAGG
TCAGGAGGTCTGCAGGCACGTCATGAATCTGGACACTAGGTGCATGGTTCAGCATCTTCA
GGTTTTCAAAGATTGTCTGGCGGATCTGGTCCAGATACTGGCGTGAGTTCTGATTCTCGA
TGCCGGTGCTGACATCTGGATGAAGTGTGAAGTCTGGGGCAAAGTACTCGAAGTATTCCC
TAT
Restriction Sites NotI-NotI     
ACCN NM_003883
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003883.2, NP_003874.2
RefSeq Size 1955 bp
RefSeq ORF 1287 bp
Locus ID 8841
UniProt ID O15379
Cytogenetics 5q31.3
Domains Hist_deacetyl
Protein Families Druggable Genome, Transcription Factors
Gene Summary Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.