RIC3 (NM_024557) Human Untagged Clone

CAT#: SC112180

Reviews ()
Write a review

RIC3 (untagged)-Human resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (RIC3), transcript variant 1



  "NM_024557" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "RIC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RIC3
Synonyms AYST720; PRO1385
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC112180 sequence for NM_024557 edited (data generated by NextGen Sequencing)
ATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGGCTTCTGGGCTTGTCCTGGCTCTGTCG
CTGCTGCTGCCCAAGGCCTTCCTGTCCCGCGGGAAGCGGCAGGAGCCGCCGCCGACACCT
GAAGGAAAATTGGGCCGATTTCCACCTATGATGCATCATCACCAGGCACCCTCAGATGGC
CAGACTCCTGGGGCTCGTTTCCAGAGGTCTCACCTTGCCGAGGCATTTGCAAAGGCCAAA
GGATCAGGTGGAGGTGCTGGAGGAGGAGGTAGTGGAAGAGGTCTGATGGGGCAGATTATT
CCAATCTACGGTTTTGGGATTTTTTTATATATACTGTACATTCTATTTAAGCTCTCAAAG
GGGAAAACAACTGCAGAGGATGGGAAATACTATACTGCCATGCCTGGAAACACCCACAGG
AAAATTACCAGTTTTGAGCTTGCTCAACTGCAAGAAAAACTGAAGGAGACAGAAGCAGCC
ATGGAAAAATTAATCAACAGAGTGGGACCTAATGGTGAGAGAGCACAGACTGTGACTTCT
GACCAAGAGAAACGGTTGCTACATCAGCTCCGAGAAATCACCAGGGTCATGAAAGAAGGA
AAATTCATTGACAGATTTTCTCCAGAGAAAGAAGCTGAGGAGGCCCCTTACATGGAGGAC
TGGGAAGGTTACCCTGAAGAGACTTACCCAATTTATGACCTTTCAGACTGTATCAAGCGT
AGGCAAGAAACAATCTTGGTGGATTACCCTGACCCAAAAGAACTTTCTGCTGAAGAAATA
GCTGAAAGAATGGGAATGATAGAAGAGGAAGAATCAGATCATTTGGGTTGGGAAAGTCTG
CCCACTGACCCCAGAGCCCAGGAAGATAATTCTGTTACCTCGTGTGATCCAAAGCCAGAA
ACATGTTCCTGCTGTTTTCATGAAGACGAGGATCCTGCTGTCTTGGCAGAGAATGCTGGA
TTCAGTGCAGATAGCTACCCTGAGCAAGAGGAAACCACCAAAGAAGAGTGGTCCCAAGAC
TTTAAAGATGAAGGGTTGGGCATCAGCACCAATAAAGCATATACAGGCAGCATGCTGAGG
AAGCGTAACCCCCAGGGTTTAGAGTGA

Clone variation with respect to NM_024557.3
389 g=>a;1051 g=>a
>OriGene 5' read for NM_024557 unedited
GTATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGCTGGCGTC
TGCACCTGCGACCACCGTGAGCAGTCATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGG
CTTCTGGGCTTGTCCTGGCTCTGTCGCTGCTGCTGCCCAAGGCCTTCCTGTCCCGCGGGA
AGCGGCAGGAGCCGCCGCCGACACCTGAAGGAAAATTGGGCCGATTTCCACCTATGATGC
ATCATCACCAGGCACCCTCAGATGGCCAGACTCCTGGGGCTCGTTTCCAGAGGTCTCACC
TTGCCGAGGCATTTGCAAAGGCCAAAGGATCAGGTGGAGGTGCTGGAGGAGGAGGTAGTG
GAAGAGGTCTGATGGGGCAGATTATTCCAATCTACGGTTTTGGGATTTTTTTATATATAC
TGTACATTCTATTTAAGCTCTCAAAGGGGAAAACAACTGCAGAGGATGGGAAATACTATA
CTGCCATGCCTGGAAACACCCACAGGAAAATTACCAGTTTTGAGCTTGCTCAACTGCAAG
AAAAACTGAAGGAGACAGAAGCAGCCATGGAAAAATTAATCAACAGAGTGGGACCTAATG
GTGAGAGAGCACAGACTGTGACTTCTGACCAAGAGAAACGGTTGCTACATCAGCTCCGAG
AAATCACCAGGGTCATGAAAGAAGGAAAATTCATTGACAGATTTTCTCCAGAGAAGAAGC
TGANGAGGCCCCTTACATGGANGACTGNGAAGGTTACCCTGAAGAGACTTACCCATTTAT
GACCTTTCAGACTGTATCAAGCGTAGGCAAGAAACATCTGGTGGATTACCCTGACCAAAA
GACTTTCTGCTGAAGAATANCTGAAGAATGGGATGATAGAGAGGAGAATAGATCATTTGG
TG
>OriGene 3' genomic read for NM_024557 unedited
GTTAAAAACCTTTTTTTTTGGCAACAAAAACCTGACCCATGATTTTGTCATCCTGGGTTG
TATATACACATATAACTGTCATCCCCAAAGGATAAAATAATTCTGGAAAATCCAAAAAGA
ATTTTCTAAATCCTAAATAACTGAAAGGTACATCCAAATGTCTGATATATAAATACACAA
ATATATTCCTTATATATAAACCAACCAAGAGCTAGGGCAGGAAGAACCACCATAAGGGCT
TAGTACTTCTGGCAGGAATTTCCATAAGCCAATTTTCCCCAAAGACCAACAACACTTTAC
ATAACAGCCTCACCAAAATACTTGAACATCCATGTATTTTCACACCCTACTGCTTTTTTC
AACAACTCTTTCTGCCAAGAGTGTCCTCTCTTCTTTGCCTACCTGAAGAAGTTCTTTGCA
TGCCTCAAGGCCCACCTCCCAAGAAACTGTGAAGTTTCTTGGCAATACTTTAGCAAAAAC
AATTTATCTTTCCTGTAGTTTTGGGCCCATGTCTGAATTACAGCATAGCCCTTATAATAA
AAACATAATTACCACTTAATGAGTGGTTATCATGTATGAGCTAGAACCAATGCTGTTTTA
CACACACTGATGATTTCATTTAACCAGGACCTTTAATACCCCTCCCTTTACTACCCTGAA
GCCAAAGCTCAGACCAGTTAAGGAGCTGACCCAAGATTCCACAGCTAGGAAATGCAGGGA
CAGATCATGGCTCATGTTTCTCTGCCTGCAAGATTCACCAATCTGAGCCCTCTTACAGGG
GCATAGTTCATTTTATCTGGCAAGCTCTCTCTCGTCACACTGAGTTTTTTGAGGGTAGAG
ATTGACCTCTGTTCCTAAACCCGGCACTGAACATTGACTGCTTAATGATGAATGAACTTC
AGAAACCACCCTT
Restriction Sites NotI-NotI     
ACCN NM_024557
Insert Size 4400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024557.2, NP_078833.2
RefSeq Size 2907 bp
RefSeq ORF 1107 bp
Locus ID 79608
UniProt ID Q7Z5B4
Cytogenetics 11p15.4
Protein Families Transmembrane
Gene Summary This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (1) encodes isoform c. The isoform designation was changed from 'a' to 'c' to be consistent with isoforms cited in PMID 18691158. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.