Vimentin(VIM) (NM_003380) Human Untagged Clone

CAT#: SC111054

VIM (untagged)-Human vimentin (VIM)

USD 196


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Vimentin(VIM) (NM_003380) Human Untagged Clone
Symbol VIM
Synonyms CTRCT30; HEL113
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111054 sequence for NM_003380 edited (data generated by NextGen Sequencing)
ATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACC
GCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTG
GGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTG
TATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTG
CAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGC
ACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAG
GTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGC
CAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAG
GTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCGAG
GACATCATGCGCCTCCGGGAGAAATTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAA
AACACCCTGCAATCTTTCAGACAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTT
GAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAG
GAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTT
TCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCT
GCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAG
GCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGG
AGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTG
GAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGAC
ACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTT
CGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTAC
AGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCC
CTGAACCTGAGGGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGG
ACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAG
CATCACGATGACCTTGAATAA

Clone variation with respect to NM_003380.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003380 unedited
GGTTTAGGATTTGTAACCGACTTACTATAGGGNCGGCACGCGCAATTCGGCACGAGGCTC
CGAGGTCCCCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCG
TTCGCCTCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCT
CCGCAGCCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCC
CGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCT
ACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGG
GCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGC
GGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGA
ACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACA
TCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGC
TCAAGGGCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGC
GCCGGCAGGTGGACCAGCTAACCAACGANCAAGCCCGCGTCGAGGTGGAGCGCGANCACC
TGGNCCGAGACATCATGCGCCTNCGGGAGAAATTGCAGGANGAGATGCTTCAGAGAGAGG
AAGCCGAAACACCCTGCAATCTTTCAGACAGGGATGTGACNATGCGTCTCTGGCACGTCT
TGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCCCTTTTGAAGAAACTCC
NCCGAAAGGAAATCCAGGAGCTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003380 unedited
ATGGACCGCGGGCCGCAATCTAGNATCGAGTTTTTTTTTTTTTTTTTTGAGTTTTTCCAA
AGATTATTGAAGCAGAACCAAGTTGGTTGGATACTTGCTGGAAAAAAAAACAGTTTTAAT
GGTATTCAAAATACCTTTTAAAAAGTATTCTAGCACAAGATTTTTCTGTAAACTAGATTA
TGTTGTAAACTTTTTTCTAAATCTTGTAGGAGTGTCGGTTGTTAAGAACTAGAGCTTATT
CCTATTCCAAATCTATCTTGCGCTCCTGAAAAACTGCAGAAAGGCACTTGAAAGCTGTTT
CTTTAAGATATGGATTTCTTTTTTATTCTTGCTGGTAATATATTGCTGCACTGAGTGTGT
GCAATTTTTATTCAAGGTCATCGTGATGCTGAGAAGTTTCGTTGATAACCTGTCCATCTC
TAGTTTCAACCGTCTTAATCAGAAGTGTCCTTTTTGAGTGGGTATCAACCAGAGGGAGTG
AATCCAGATTAGTTTCCCTCAGGTTCAGGGAGGAAAAGTTTGGAAGAGGCAGAGAAATCC
TGCTCTCCTCGCCTTCCAGCAGCTTCCTGTAGGTGGCAATCTCAATGTCAAGGGCCATCT
TAACATTGAGCAGGTCTTGGTATTCACGAAGGTGACGAGCCATTTCCTCCTTCATATTCT
GAATCTCATCCTGCAGGCGGCCAATAGTGTCTTGGTAGTTAGCAGCTTCAACGGCAAAGT
TCTCTTCCATTTCACGCATCTGGCGTTCCAGGAACTCATTGGTTCCTTTAGGGCCTCCAC
TCACAGGTGAAGGACTGCACCTGTCTCCGGACTTAGTGGACTCCTGCCTTGCCTGCCGCA
AGCGCGTATTGTTCCGGTTGGCAACCTAAAGAGTCAGCAACTCGGATTTGCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003380
ORF Size 1401 bp
Insert Size 1960
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003380.2, NP_003371
RefSeq Size 1847
RefSeq ORF 1401
Locus ID 7431
Cytogenetics 10p13
Domains filament, filament_head
Protein Families ES Cell Differentiation/IPS
Gene Summary This gene encodes a member of the intermediate filament family. Intermediate filamentents, along with microtubules and actin microfilaments, make up the cytoskeleton. The protein encoded by this gene is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. It is also involved in the immune response, and controls the transport of low-density lipoprotein (LDL)-derived cholesterol from a lysosome to the site of esterification. It functions as an organizer of a number of critical proteins involved in attachment, migration, and cell signaling. Mutations in this gene causes a dominant, pulverulent cataract.[provided by RefSeq, Jun 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations