CCR5 (NM_000579) Human Untagged Clone

SKU
SC110858
CCR5 (untagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCR5
Synonyms CC-CKR-5; CCCKR5; CCR-5; CD195; CKR-5; CKR5; CMKBR5; IDDM22
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000579, RT-PCR generated
ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGG
CTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
CATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATC
TTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACT
CTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATC
ATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTC
CAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAG
GTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTC
GGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTC
TGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACC
CGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000579 unedited
TTGGAACCCAAGTACGGTATTTGTTACACNATACACTATAGGCGGCCGCGCAATCANATC
TGGTACCGAGCTCGGCTCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTTGATCG
GAACAAGATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGA
GCCCTGCCAAAAAATAATGTGAAGCANATCGCAGCCCGTCTTTTTCTCCGCTCTACTCAC
TGGTGATCATCTTTGGTTTTGAGGGCAACAAGCTGGGCCAACCCCATTCCGAAAAACCGC
CAAAGGGTTTAAAAAACAGGGTTTGATTTTAACGGGGTAAACCGGGGAAATTTTTAAGCG
GGGTTTTTTTTTTTTAAAAGCCCCCCTTTTGGGGGGAAAAAATATTTTTCCCCCCCCCCC
GGGGGGTTTGGTTAAAAAAAAAAAAAAAAGGGTTTTTTTTTGTGGGGGGGGGGGGGGGAN
AATAAAAAAGGAAGGGGGGGGGGGGGGGGGGGGAAAAAAAAAAATAATGACCCTTTCCCC
TCCCAAAAAAAAAAAAAAAAAAGAAAAAAAAGAATACGCTCGTGGGGGGTGGGGATAGAA
TGNGNAGAAAGAAAAAAAAAAAGCACCCCCCCACAACTCTTATACAACTATTGTGTGCGG
GTGAAAGAAAAAAAAAAAAATATATTTCGCGGGGGGGGGGGGTTAGGTTNTTTATTTTTT
TTANNNTNTNNNCCTTTCTAAAGGCCCCCTCTTCTGTCCAATTATAGAGATAAGAAGTAA
GAGGGTGAGGGGAGCGGCGAGGGTCCTGCTCGCCTCCCTACACCTCTGATTTTCCCGCGG
GGCGAAAGAAAACAAAACGACAATAAAAAAAAAAAAAAAC
Restriction Sites Please inquire
ACCN NM_000579
Insert Size 3700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000579.1, NP_000570.1
RefSeq Size 3655 bp
RefSeq ORF 1059 bp
Locus ID 1234
UniProt ID P51681
Cytogenetics 3p21.31
Protein Families Druggable Genome, ES Cell Differentiation/IPS, GPCR, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis
Summary This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (A) represents the longer transcript. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by published experimental evidence.
Write Your Own Review
You're reviewing:CCR5 (NM_000579) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223291 CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A 10 ug
$686.00
RC223291L1 Lenti-ORF clone of CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A 10 ug
$986.00
RC223291L2 Lenti-ORF clone of CCR5 (mGFP-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A 10 ug
$986.00
RC223291L3 Lenti-ORF clone of CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A 10 ug
$986.00
RC223291L4 Lenti-ORF clone of CCR5 (mGFP-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A 10 ug
$986.00
RG223291 CCR5 (tGFP-tagged) - Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant A 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.