Ceramide synthase 2 (CERS2) (NM_181746) Human Untagged Clone

SKU
SC110411
CERS2 (untagged)-Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Ceramide synthase 2
Synonyms L3; LASS2; SP260; TMSG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC110411 representing NM_181746.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCCAGACCTTGTATGATTACTTCTGGTGGGAACGTCTGTGGCTGCCTGTGAACTTGACCTGGGCC
GATCTAGAAGACCGAGATGGACGTGTCTACGCCAAAGCCTCAGATCTCTATATCACGCTGCCCCTGGCC
TTGCTCTTCCTCATCGTTCGATACTTCTTTGAGCTGTACGTGGCTACACCACTGGCTGCCCTCTTGAAC
ATAAAGGAGAAAACTCGGCTGCGGGCACCTCCCAACGCCACCTTGGAACATTTCTACCTGACCAGTGGC
AAGCAGCCCAAGCAGGTGGAAGTAGAGCTTTTGTCCCGGCAGAGCGGGCTCTCTGGCCGCCAGGTAGAG
CGTTGGTTCCGTCGCCGCCGCAACCAGGACCGGCCCAGTCTCCTCAAGAAGTTCCGAGAAGCCAGCTGG
AGATTCACATTTTACCTGATTGCCTTCATTGCCGGCATGGCCGTCATTGTGGATAAACCCTGGTTCTAT
GACATGAAGAAAGTTTGGGAGGGATATCCCATACAGAGCACTATCCCTTCCCAGTATTGGTACTACATG
ATTGAACTTTCCTTCTACTGGTCCCTGCTCTTCAGCATTGCCTCTGATGTCAAGCGAAAGGATTTCAAG
GAACAGATCATCCACCATGTGGCCACCATCATTCTCATCAGCTTTTCCTGGTTTGCCAATTACATCCGA
GCTGGGACTCTAATCATGGCTCTGCATGACTCTTCCGATTACCTGCTGGAGTCAGCCAAGATGTTTAAC
TACGCGGGATGGAAGAACACCTGCAACAACATCTTCATCGTCTTCGCCATTGTTTTTATCATCACCCGA
CTGGTCATCCTGCCCTTCTGGATCCTGCATTGCACCCTGGTGTACCCACTGGAGCTCTATCCTGCCTTC
TTTGGCTATTACTTCTTCAATTCCATGATGGGAGTTCTACAGCTGCTGCATATCTTCTGGGCCTACCTC
ATTTTGCGCATGGCCCACAAGTTCATAACTGGAAAGCTGGTAGAAGATGAACGCAGTGACCGGGAAGAA
ACAGAGAGCTCAGAGGGGGAGGAGGCTGCAGCTGGGGGAGGAGCAAAGAGCCGGCCCCTAGCCAATGGC
CACCCCATCCTCAATAACAACCATCGTAAGAATGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_181746
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181746.1
RefSeq Size 2544 bp
RefSeq ORF 1143 bp
Locus ID 29956
UniProt ID Q96G23
Cytogenetics 1q21.3
Protein Families Transcription Factors, Transmembrane
MW 44.9 kDa
Summary This gene encodes a protein that has sequence similarity to yeast longevity assurance gene 1. Mutation or overexpression of the related gene in yeast has been shown to alter yeast lifespan. The human protein may play a role in the regulation of cell growth. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:Ceramide synthase 2 (CERS2) (NM_181746) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215300 CERS2 (Myc-DDK-tagged)-Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC215300L1 Lenti ORF clone of Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC215300L2 Lenti ORF clone of Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1, mGFP tagged 10 ug
$757.00
RC215300L3 Lenti ORF clone of Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC215300L4 Lenti ORF clone of Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1, mGFP tagged 10 ug
$757.00
RG215300 CERS2 (tGFP-tagged) - Human LAG1 homolog, ceramide synthase 2 (LASS2), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.