Apolipoprotein L 1 (APOL1) (NM_003661) Human Untagged Clone

CAT#: SC109941

Reviews ()
Write a review

APOL1 (untagged)-Human apolipoprotein L, 1 (APOL1), transcript variant 1



Reconstitution Protocol

USD 836.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol APOL1
Synonyms APO-L; APOL; APOL-I; FSGS4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC109941 sequence for NM_003661 edited (data generated by NextGen Sequencing)
ATGGAGGGAGCTGCTTTGCTGAGAGTCTCTGTCCTCTGCATCTGGATGAGTGCACTTTTC
CTTGGTGTGGGAGTGAGGGCAGAGGAAGCTGGAGCGAGGGTGCAACAAAACGTTCCAAGT
GGGACAGATACTGGAGATCCTCAAAGTAAGCCCCTCGGTGACTGGGCTGCTGGCACCATG
GACCCAGAGAGCAGTATCTTTATTGAGGATGCCATTAAGTATTTCAAGGAAAAAGTGAGC
ACACAGAATCTGCTACTCCTGCTGACTGATAATGAGGCCTGGAACGGATTCGTGGCTGCT
GCTGAACTGCCCAGGAATGAGGCAGATGAGCTCCGTAAAGCTCTGGACAACCTTGCAAGA
CAAATGATCATGAAAGACAAAAACTGGCACGATAAAGGCCAGCAGTACAGAAACTGGTTT
CTGAAAGAGTTTCCTCGGTTGAAAAGTGAGCTTGAGGATAACATAAGAAGGCTCCGTGCC
CTTGCAGATGGGGTTCAGAAGGTCCACAAAGGCACCACCATCGCCAATGTGGTGTCTGGC
TCTCTCAGCATTTCCTCTGGCATCCTGACCCTCGTCGGCATGGGTCTGGCACCCTTCACA
GAGGGAGGCAGCCTTGTACTCTTGGAACCTGGGATGGAGTTGGGAATCACAGCCGCTTTG
ACCGGGATTACCAGCAGTACCATGGACTACGGAAAGAAGTGGTGGACACAAGCCCAAGCC
CACGACCTGGTCATCAAAAGCCTTGACAAATTGAAGGAGGTGAAGGAGTTTTTGGGTGAG
AACATATCCAACTTTCTTTCCTTAGCTGGCAATACTTACCAACTCACACGAGGCATTGGG
AAGGACATCCGTGCCCTCAGACGAGCCAGAGCCAATCTTCAGTCAGTACCGCATGCCTCA
GCCTCACGCCCCCGGGTCACTGAGCCAATCTCAGCTGAAAGCGGTGAACAGGTGGAGAGA
GTTAATGAACCCAGCATCCTGGAAATGAGCAGAGGAGTCAAGCTCACGGATGTGGCCCCT
GTAAGCTTCTTTCTTGTGCTGGATGTAGTCTACCTCGTGTACGAATCAAAGCACTTACAT
GAGGGGGCAAAGTCAGAGACAGCTGAGGAGCTGAAGAAGGTGGCTCAGGAGCTGGAGGAG
AAGCTAAACATTCTCAACAATAATTATAAGATTCTGCAGGCGGACCAAGAACTGTGA

Clone variation with respect to NM_003661.3
764 g=>a;960 g=>a
>OriGene 5' read for NM_003661 unedited
TACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTCAGAACAGCTGGATCTTGC
TCAGTCTCTGCCAGGGGAAGATTCCTTGGAGGAGGCCCTGCAGCGACATGGAGGGAGCTG
CTTTGCTGAGAGTCTCTGTCCTCTGCATCTGGATGAGTGCACTTTTCCTTGGTGTGGGAG
TGAGGGCAGAGGAAGCTGGAGCGAGGGTGCAACAAAACGTTCCAAGTGGGACAGATACTG
GAGATCCTCAAAGTAAGCCCCTCGGTGACTGGGCTGCTGGCACCATGGACCCAGAGAGCA
GTATCTTTATTGAGGATGCCATTAAGTATTTCAAGGAAAAAGTGAGCACACAGAATCTGC
TACTCCTGCTGACTGATAATGAGGCCTGGAACGGATTCGTGGCTGCTGCTGAACTGCCCA
GGAATGAGGCAGATGAGCTCCGTAAAGCTCTGGACAACCTTGCAAGACAAATGATCATGA
AAGACAAAAACTGGCACGATAAAGGCCAGCAGTACAGAAACTGGTTTCTGAAAGAGTTTC
CTCGGTTGAAAAGTAAGCTTGAGGATAACATAAGAAGGCTCCGTGCCCTTGCAGATGGGG
TTCAGAAGGTCCACAAAGGCACCACCATCGCCAATGTGGNTGTCTGGCTCTCTCAGCATT
TCCTCTGGCATCCTGACCCTCGTCGGCATGGGTTTGGCACCCTTCACAGAGGGAGGCAGC
CTTGTACTCTTGGAACCTGNGNNATGGAGTGGNAATCACAGCAGCTTTGACCGGGGATAC
CAGCAGTACATAGACTACGNAANGAAGTGGTGGGACACAGCCCAAGCCCACGACTGGTCA
TCANAAGCTTGACANNATGANGAGTGAANGGGAGTTTTGGGTGAGACATTATCACTTTCT
TTNCTAGCTGGCATACTTACACTACACGAGCATGGGAGGGACTNCTGCCTAGACAGCAAG
CATTTTATCATACGATGCTAGCTACCCCCGGTC
>OriGene 3' read for NM_003661 unedited
CTATGGCACGCGGCACGCAATCTAGAATCGAGTTTTTTTTTTTTTTTTTTGAGAGGAGTC
TCGCTCTGTCACCCAGGCTGGAGTGCAGTGGCGATATCTCGGCTCACTGCAAGCTCCACC
TCCCAGGCTCACGCCATTCTCCTGCCTCAGCCGCCCAGTCAGCCGGAACCACAGGCGCCC
GCCACCATGCCCGGCCAATTTTTTGTATTTTTAGTAGAGACGGGGTTTCACCGTGCTAGC
CAGGATGGCCTCGATCTCCTGACCTCGTGATCCGCCCGCCTTGGCCTCCCAAAGTGCCCG
GACCACAGGCATGAGCCACTGCGCCCGGACCCCCAATATATTCTTTAGTCTAAAGCAAAC
TGCTTCTTCCCATTCCCCACACTCTGCAGTTCCCATTTTTCCCTTATTGCAGGCTCAAAT
GTTCCTGCCTTATACTTGCTGCACTGCCATCTGCATTAACCCCTCCCCTGCTGTGCTCAC
CTATGGAAATGCCAAAGCCCCTAACACTCAGTTCCATAAACTTTACCTGACCCTCTTTAT
CCCCCTAATAAAATGTTTGCATTTGGGCCAAAACCGATGGCTCACGCCTGTAATCCCACT
ACTTTGGGAGGCCAAGGTGGGCATATCAACAGGCCAGGAGATCGACACCATCCTGGCGCA
CACGGCCGAAACCCCATCTCTATTAAAAATTCCCAAATTACCTGGGCAGGCNGGCAACCG
CCTGTTTACTCAACTACTTGGGCAGGCCAAGGCAGGAGAATCCGCTTGACATGGGAAGAC
ACCCCTGTCTGGACCCAGATCGCCCCACTGCACTCCACTTTGCGAACAGACAAGACTTTG
GCTCAAACAAAAAAAAATAGTTTGCTTTTGGCCTGCGCCCCGCCAGCTTATCTTTCTGGG
GGTGGACTGCCCGGAGCCCACATCCGCCCCCCCTCTCAATATTTAACCCCCCATAATCTC
CCCTCCATT
Restriction Sites NotI-NotI     
ACCN NM_003661
Insert Size 2140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003661.2, NP_003652.2
RefSeq Size 2856 bp
RefSeq ORF 1197 bp
Locus ID 8542
UniProt ID O14791
Cytogenetics 22q12.3
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a secreted high density lipoprotein which binds to apolipoprotein A-I. Apolipoprotein A-I is a relatively abundant plasma protein and is the major apoprotein of HDL. It is involved in the formation of most cholesteryl esters in plasma and also promotes efflux of cholesterol from cells. This apolipoprotein L family member may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Several different transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (1) encodes the predominant protein (isoform a). Variants 1 and 3 encode the same protein (isoform a). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Other products for "APOL1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.