PKI alpha (PKIA) (NM_181839) Human Untagged Clone
SKU
SC109614
PKIA (untagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PKI alpha |
Synonyms | PRKACN1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_181839, the custom clone sequence may differ by one or more nucleotides
ATGACTGATGTGGAAACTACATATGCAGATTTTATTGCTTCAGGAAGAACAGGTAGAAGAAATGCAATAC ATGATATCCTGGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTGAAATTAGCAGGTCTTGATAT CAACAAGACAGAAGGTGAAGAAGATGCACAACGAAGTTCTACAGAACAAAGTGGGGAAGCCCAGGGAGAA GCAGCAAAATCTGAAAGCTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_181839 unedited
ATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGGCGCGAGCTGACCGAGC ACTCGGCGGGCGCGGCGGGACTGCGGCCCGTGGCGGCGTGCGCGGGGACCTGCGCTGACT AGGTCCGGGGAAGTCCCTGCTATGTGGATATTTGGTAGCAATGACTGATGTGGAAACTAC ATATGCAGATTTTATTGCTTCAGGAAGAACAGGTAGAAGAAATGCAATACATGATATCCT GGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTGAAATTAGCAGGTCTTGATAT CAACAAGACAGAAGGTGAAGAAGATGCACAACGAAGTTCTACAGAACAAAGTGGGGAAGC CCAGGGAGAAGCAGCAAAATCTGAAAGCTAACACCCCACTTTGACCCTCGACCACACCTG AAAATGTCTCAAATCTCCAGGAGTATCTGGAATGCATTTGTTTCCATGAGTGAAAAGAGG AAAAAGAAAATGGCTGTGCTGCATTGCAGGAACCTGCTCATTATCATGTTAAAAATGAGG GCAGAGGCTGTGGCTGCAGGCAGACTTTTCCCTACCTCTGTCATTAGCAATGGTTGAAAT CATGTGGCTTGTGTTTGGGCGTCATTNTTGTATGGATCCTTTCACTTGATCATATGACGA AATGCTTATAGAGAGTAGCTCCGACCTAGATGATGATTCTTCCTGTAGCATCTGGCCCCT CACATGTCAGAGGATNTAATTGTGTCAATTGCGAAAGGTTGATTGAACCCCAGAGTTTAA TATCTCTGCTCTCAAGTNTCACCCAGTANNAAGAAGATCCAGAAGCCACTGGTTTAGCAT ACGAANACCGGGNGGTACAGGGCGGGGTATTACACCGGGTTTGGGAATGGACAATTAATA TGCTCGCACTGCCCCTTCTCTGATTGCTATGAAACAAATGAGTACATACGTGGGGAATTT ATACATCTTTTAAAAGGGCGGGCTTTCTNTTTAGTCTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_181839 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_181839.1, NP_862822.1 |
RefSeq Size | 2055 bp |
RefSeq ORF | 231 bp |
Locus ID | 5569 |
UniProt ID | P61925 |
Cytogenetics | 8q21.13 |
Protein Families | Druggable Genome |
Summary | The protein encoded by this gene is a member of the cAMP-dependent protein kinase (PKA) inhibitor family. This protein was demonstrated to interact with and inhibit the activities of both C alpha and C beta catalytic subunits of the PKA. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the 5' UTR, as compared to variant 1. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC204652 | PKIA (Myc-DDK-tagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2 | 10 ug |
$150.00
|
|
RC204652L3 | Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC204652L4 | Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2, mGFP tagged | 10 ug |
$450.00
|
|
RG204652 | PKIA (tGFP-tagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2 | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.