PKI alpha (PKIA) (NM_181839) Human Untagged Clone

SKU
SC109614
PKIA (untagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PKI alpha
Synonyms PRKACN1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_181839, the custom clone sequence may differ by one or more nucleotides


ATGACTGATGTGGAAACTACATATGCAGATTTTATTGCTTCAGGAAGAACAGGTAGAAGAAATGCAATAC
ATGATATCCTGGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTGAAATTAGCAGGTCTTGATAT
CAACAAGACAGAAGGTGAAGAAGATGCACAACGAAGTTCTACAGAACAAAGTGGGGAAGCCCAGGGAGAA
GCAGCAAAATCTGAAAGCTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_181839 unedited
ATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGGCGCGAGCTGACCGAGC
ACTCGGCGGGCGCGGCGGGACTGCGGCCCGTGGCGGCGTGCGCGGGGACCTGCGCTGACT
AGGTCCGGGGAAGTCCCTGCTATGTGGATATTTGGTAGCAATGACTGATGTGGAAACTAC
ATATGCAGATTTTATTGCTTCAGGAAGAACAGGTAGAAGAAATGCAATACATGATATCCT
GGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTGAAATTAGCAGGTCTTGATAT
CAACAAGACAGAAGGTGAAGAAGATGCACAACGAAGTTCTACAGAACAAAGTGGGGAAGC
CCAGGGAGAAGCAGCAAAATCTGAAAGCTAACACCCCACTTTGACCCTCGACCACACCTG
AAAATGTCTCAAATCTCCAGGAGTATCTGGAATGCATTTGTTTCCATGAGTGAAAAGAGG
AAAAAGAAAATGGCTGTGCTGCATTGCAGGAACCTGCTCATTATCATGTTAAAAATGAGG
GCAGAGGCTGTGGCTGCAGGCAGACTTTTCCCTACCTCTGTCATTAGCAATGGTTGAAAT
CATGTGGCTTGTGTTTGGGCGTCATTNTTGTATGGATCCTTTCACTTGATCATATGACGA
AATGCTTATAGAGAGTAGCTCCGACCTAGATGATGATTCTTCCTGTAGCATCTGGCCCCT
CACATGTCAGAGGATNTAATTGTGTCAATTGCGAAAGGTTGATTGAACCCCAGAGTTTAA
TATCTCTGCTCTCAAGTNTCACCCAGTANNAAGAAGATCCAGAAGCCACTGGTTTAGCAT
ACGAANACCGGGNGGTACAGGGCGGGGTATTACACCGGGTTTGGGAATGGACAATTAATA
TGCTCGCACTGCCCCTTCTCTGATTGCTATGAAACAAATGAGTACATACGTGGGGAATTT
ATACATCTTTTAAAAGGGCGGGCTTTCTNTTTAGTCTAA
Restriction Sites NotI-NotI
ACCN NM_181839
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181839.1, NP_862822.1
RefSeq Size 2055 bp
RefSeq ORF 231 bp
Locus ID 5569
UniProt ID P61925
Cytogenetics 8q21.13
Protein Families Druggable Genome
Summary The protein encoded by this gene is a member of the cAMP-dependent protein kinase (PKA) inhibitor family. This protein was demonstrated to interact with and inhibit the activities of both C alpha and C beta catalytic subunits of the PKA. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an exon in the 5' UTR, as compared to variant 1. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PKI alpha (PKIA) (NM_181839) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204652 PKIA (Myc-DDK-tagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2 10 ug
$150.00
RC204652L3 Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC204652L4 Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2, mGFP tagged 10 ug
$450.00
RG204652 PKIA (tGFP-tagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 2 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.